Transcript: Mouse NM_025699.2

Mus musculus oxidative stress responsive serine rich 1 (Oser1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Oser1 (66680)
Length:
1583
CDS:
104..979

Additional Resources:

NCBI RefSeq record:
NM_025699.2
NBCI Gene record:
Oser1 (66680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215950 CCTTATAAGACAGCATATTTC pLKO.1 1262 3UTR 100% 13.200 10.560 N Oser1 n/a
2 TRCN0000264840 CTAACGATCTCTCTGACTTTC pLKO_005 639 CDS 100% 10.800 8.640 N Oser1 n/a
3 TRCN0000182781 CCCAGAACGAAGATCACTTGA pLKO.1 784 CDS 100% 4.950 3.960 N Oser1 n/a
4 TRCN0000178069 GCTAACGATCTCTCTGACTTT pLKO.1 638 CDS 100% 4.950 3.960 N Oser1 n/a
5 TRCN0000264838 TCCTTATAAGACAGCATATTT pLKO_005 1261 3UTR 100% 15.000 10.500 N Oser1 n/a
6 TRCN0000264837 ACGCATCAGGGTCCATCATAT pLKO_005 171 CDS 100% 13.200 9.240 N Oser1 n/a
7 TRCN0000283193 GCAGGCTACATGGAGTATTAC pLKO_005 908 CDS 100% 13.200 9.240 N Oser1 n/a
8 TRCN0000264839 CAGAACAGCAGCCGATGATAC pLKO_005 232 CDS 100% 10.800 7.560 N Oser1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025699.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03326 pDONR223 100% 87.7% 86.6% None (many diffs) n/a
2 ccsbBroad304_03326 pLX_304 0% 87.7% 86.6% V5 (many diffs) n/a
3 TRCN0000465748 CGGTTCTCTACCTAGACCACAACC pLX_317 43.4% 87.7% 86.6% V5 (many diffs) n/a
Download CSV