Construct: ORF TRCN0000466008
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014957.1_s317c1
- Derived from:
- ccsbBroadEn_11568
- DNA Barcode:
- GCCGTCTACCAATAGACCACACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTMR11 (10903)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466008
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10903 | MTMR11 | myotubularin related protei... | XM_024452592.1 | 61.8% | 61.2% | (many diffs) |
2 | human | 10903 | MTMR11 | myotubularin related protei... | XM_011509099.3 | 57.3% | 56.7% | (many diffs) |
3 | human | 10903 | MTMR11 | myotubularin related protei... | XM_024452577.1 | 34.6% | 34.3% | (many diffs) |
4 | human | 10903 | MTMR11 | myotubularin related protei... | NM_001145862.2 | 33.3% | 33% | (many diffs) |
5 | human | 10903 | MTMR11 | myotubularin related protei... | XM_006711137.1 | 28.1% | 27.4% | (many diffs) |
6 | human | 10903 | MTMR11 | myotubularin related protei... | NM_181873.3 | 28% | 27.3% | (many diffs) |
7 | human | 10903 | MTMR11 | myotubularin related protei... | XM_024452578.1 | 27.4% | 27% | (many diffs) |
8 | human | 10903 | MTMR11 | myotubularin related protei... | XR_426760.4 | 25.9% | (many diffs) | |
9 | human | 10903 | MTMR11 | myotubularin related protei... | XR_002959043.1 | 25.1% | (many diffs) | |
10 | human | 10903 | MTMR11 | myotubularin related protei... | XR_002959062.1 | 24.1% | (many diffs) | |
11 | human | 10903 | MTMR11 | myotubularin related protei... | XR_002959066.1 | 21.2% | (many diffs) | |
12 | human | 10903 | MTMR11 | myotubularin related protei... | XR_002959067.1 | 14.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 786
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggagcccagg agtcgtcagc ctagcagttg cctggcctcc agatgcctcc 121 caggggagca gatcctagca tgggccccag gggtgaggaa gggcctggaa ccagaattgt 181 ctggaaccct gatctgtacc aactttaggg tcaccttcca gccctgtgga tggcagtgga 241 atcaggacac tcccttgaac agtgaatacg attttgccct ggtcaacatt ggacgattag 301 aggctgtgag cggcttgtcc cgagtccagc tcctccgtcc agggtccctg cataaattta 361 tccctgagga gattctgatt catggccgag acttccggct gctcagagtt ggttttgagg 421 ctggaggcct agagcctcag gctttTCAGG TGACCATGGC CATTGTCCAA GCCAGAGCTC 481 AGAGCAATCA AGCCCAACAG TATTCGGGGA TAACCCTGAG CAAGGCTGGC CAGGGTTCTG 541 GCTCCAGAAA ACCACCAATT CCTCTCATGG AGACAGCGGA AGACTGGGAG ACTGAGCGGA 601 AGAAGCAGGC AGCCAGAGGC TGGAGGGTCA GCACGGTCAA CGAGAGGTTC GACGTAGCCA 661 CCAGCCTCCC CCGTTACTTC TGGGTCCCTA ACCGAATTCT GGACAGTGAG GTCAGGAGAG 721 CATTTGGCCA CTTTCATCAG GGCCGTGGAC CGGTCAGTGT GATGGTTAGG GTAATGGCTG 781 TGGATTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 841 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 901 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCCGTCTAC CAATAGACCA CACTTACGCG 961 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt