Construct: ORF TRCN0000466011
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000922.1_s317c1
- Derived from:
- ccsbBroadEn_04195
- DNA Barcode:
- GTCTACCCGGTGCTCGGTATTGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CEP63 (80254)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466011
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001042383.2 | 100% | 100% | |
2 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353119.1 | 100% | 100% | |
3 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353120.1 | 100% | 100% | |
4 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353121.1 | 100% | 100% | |
5 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353122.1 | 100% | 100% | |
6 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353118.1 | 97.6% | 95.6% | 1_31del;70_71insGGTG |
7 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353125.1 | 94.3% | 94.3% | 0_1ins84 |
8 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453778.1 | 94.3% | 94.3% | 0_1ins84 |
9 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001042384.2 | 91.9% | 89.4% | (many diffs) |
10 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353123.1 | 91.9% | 89.4% | (many diffs) |
11 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353124.1 | 91.9% | 89.4% | (many diffs) |
12 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001042400.2 | 91.4% | 91.4% | 928_1065del |
13 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353110.1 | 91.4% | 91.4% | 928_1065del |
14 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353111.1 | 91.4% | 91.4% | 928_1065del |
15 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353112.1 | 91.4% | 91.4% | 928_1065del |
16 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453776.1 | 89.6% | 89.6% | 1_33del;961_1098del |
17 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453779.1 | 86.3% | 83.8% | (many diffs) |
18 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453775.1 | 86.3% | 86.3% | 0_1ins84;844_981del |
19 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353113.1 | 84.2% | 81.9% | (many diffs) |
20 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353117.1 | 84.2% | 81.9% | (many diffs) |
21 | human | 80254 | CEP63 | centrosomal protein 63 | XR_002959589.1 | 81.7% | (many diffs) | |
22 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453777.1 | 79.1% | 76.7% | (many diffs) |
23 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453774.1 | 76.1% | 72.4% | (many diffs) |
24 | human | 80254 | CEP63 | centrosomal protein 63 | XR_001740278.1 | 75.7% | (many diffs) | |
25 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353126.1 | 75.5% | 75.5% | 0_1ins363 |
26 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353109.1 | 75.3% | 75.3% | 1329_1814del |
27 | human | 80254 | CEP63 | centrosomal protein 63 | XM_017007247.2 | 75.3% | 75.3% | 1329_1814del |
28 | human | 80254 | CEP63 | centrosomal protein 63 | XM_017007248.2 | 75.3% | 75.3% | 1329_1814del |
29 | human | 80254 | CEP63 | centrosomal protein 63 | XM_017007249.1 | 75.3% | 75.3% | 1329_1814del |
30 | human | 80254 | CEP63 | centrosomal protein 63 | XR_002959590.1 | 72.8% | (many diffs) | |
31 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453770.1 | 71% | 71% | 0_1ins84;1245_1730del |
32 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453772.1 | 70.6% | 67.1% | (many diffs) |
33 | human | 80254 | CEP63 | centrosomal protein 63 | NM_001353108.2 | 70.4% | 70.4% | 928_1065del;1467_1952del |
34 | human | 80254 | CEP63 | centrosomal protein 63 | NM_025180.4 | 70.4% | 70.4% | 928_1065del;1467_1952del |
35 | human | 80254 | CEP63 | centrosomal protein 63 | XM_005247797.3 | 70.4% | 70.4% | 928_1065del;1467_1952del |
36 | human | 80254 | CEP63 | centrosomal protein 63 | XM_006713760.4 | 70.4% | 70.4% | 928_1065del;1467_1952del |
37 | human | 80254 | CEP63 | centrosomal protein 63 | XR_002959587.1 | 69.5% | (many diffs) | |
38 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453768.1 | 69.3% | 69.3% | 1_33del;961_1098del;1500_1985del |
39 | human | 80254 | CEP63 | centrosomal protein 63 | XM_005247795.5 | 69.2% | 67.7% | (many diffs) |
40 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453769.1 | 66.4% | 66.4% | 0_1ins84;844_981del;1383_1868del |
41 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453771.1 | 66.4% | 66.4% | 0_1ins84;844_981del;1383_1868del |
42 | human | 80254 | CEP63 | centrosomal protein 63 | XM_024453773.1 | 66.4% | 66.4% | 0_1ins84;844_981del;1383_1868del |
43 | human | 80254 | CEP63 | centrosomal protein 63 | XR_002959588.1 | 64.5% | (many diffs) | |
44 | human | 80254 | CEP63 | centrosomal protein 63 | XM_005247799.3 | 53.2% | 53.2% | 0_1ins363;565_702del;1104_1589del |
45 | human | 80254 | CEP63 | centrosomal protein 63 | XM_017007252.1 | 53.2% | 53.2% | 0_1ins363;565_702del;1104_1589del |
46 | human | 80254 | CEP63 | centrosomal protein 63 | XR_002959586.1 | 42.2% | (many diffs) | |
47 | human | 80254 | CEP63 | centrosomal protein 63 | NR_148355.1 | 27% | 1_354del;1682_1837del;1996_5491del | |
48 | human | 80254 | CEP63 | centrosomal protein 63 | NR_148354.1 | 26.8% | 1_409del;1336_1469del;2029_5524del | |
49 | human | 80254 | CEP63 | centrosomal protein 63 | NR_148353.1 | 26.7% | 1_409del;1737_1892del;2051_5546del | |
50 | human | 80254 | CEP63 | centrosomal protein 63 | NR_148352.1 | 26.1% | 1_409del;1738_2017del;2175_5670del | |
51 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313414.1 | 77.3% | 78.8% | (many diffs) |
52 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313415.1 | 71.1% | 72.3% | (many diffs) |
53 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313413.1 | 70.6% | 72% | (many diffs) |
54 | mouse | 28135 | Cep63 | centrosomal protein 63 | NM_001301689.1 | 69.7% | 71.1% | (many diffs) |
55 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313412.1 | 69.3% | 70.7% | (many diffs) |
56 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313411.1 | 69.2% | 70.5% | (many diffs) |
57 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_011242890.2 | 67.4% | 68.7% | (many diffs) |
58 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_006511745.3 | 59.7% | 60.6% | (many diffs) |
59 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313410.1 | 59.7% | 60.6% | (many diffs) |
60 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_006511744.3 | 58.4% | 59.2% | (many diffs) |
61 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_006511741.1 | 55.7% | 56.5% | (many diffs) |
62 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_011242885.2 | 55.6% | 56.4% | (many diffs) |
63 | mouse | 28135 | Cep63 | centrosomal protein 63 | NM_001081122.1 | 55.2% | 55.9% | (many diffs) |
64 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_006511747.3 | 55% | 55.6% | (many diffs) |
65 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313409.1 | 54.9% | 55.7% | (many diffs) |
66 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_011242884.1 | 54.8% | 55.6% | (many diffs) |
67 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313408.1 | 54.8% | 55.6% | (many diffs) |
68 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_011242883.1 | 54.5% | 55.3% | (many diffs) |
69 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313407.1 | 54.4% | 55.2% | (many diffs) |
70 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_011242882.1 | 54% | 54.8% | (many diffs) |
71 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_006511739.1 | 53.7% | 54.5% | (many diffs) |
72 | mouse | 28135 | Cep63 | centrosomal protein 63 | XM_017313406.1 | 53.7% | 54.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1551
- ORF length:
- 1485
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggctttgtta gaaggaatac aaaatcgagg gcatggtggg ggatttttga 121 catcttgtga agcagaacta caggagctca tgaaacagat tgacataatg gtggctcata 181 aaaaatctga atgggaagga cgtacacatg ctctagaaac ttgcttgaaa atccgtgaac 241 aggaacttaa gagtcttagg agtcagttgg atgtgacaca taaggaggtt ggaatgttgc 301 atcagcaggt agaagaacat gaaaaaatca agcaagagat gaccatggaa tataagcagg 361 agttgaagaa actacatgaa gaattatgca tactgaagag aagctatgaa aagcttcaga 421 aaaagcaaat gagggaattc agaggaaata ccaaaaatca cagggaagat cggtctgaaa 481 ttgagaggtt aactgcaaaa atagaggaat tccgtcagaa atcgctggac tgggagaagc 541 aacgcttgat ttatcagcaa caggtatctt cactggaggc acaaaggaag gctctggctg 601 aacaatcaga gataattcag gctcagcttg tcaatcggaa acagaaatta gagtctgtgg 661 aactttctag ccaatcagaa attcaacact taagcagtaa actggagcgg gctaatgaca 721 ctatctgtgc caatgagttg gaaatagagc gcctcaccat gagggtcaat gacttggttg 781 gaaccagtat gactgtccta caggagcagc agcaaaaaga agaaaaattg agggaatctg 841 aaaaactatt agaggctctg caggaagaaa agagagaatt gaaggcagct cttcagtctc 901 aagaaaatct catacatgag gccagaatac aaaaggagaa gttacaagaa aaagtaaagg 961 caactaacac tcaacatgct gtagaagcta taagtttgga atctgtgagt gcaacgtgta 1021 aacagctgag ccaagaacta atggaaaaat atgaagaact gaagaggatg gaagcacata 1081 acaatgaata caaagcagag attaagaagt tgaaagaaca gattttacag ggtgaacaaa 1141 gttacagttc tgcactagaa ggaatgaaga tggaaatctc ccatctaact caggagttac 1201 atcagcgaga tatcactatt gcttccacca aaggttcttc cTCAGACATG GAAAAGCGAC 1261 TCAGAGCAGA GATGCAAAAG GCAGAAGACA AAGCAGTAGA GCATAAGGAG ATTTTGGATC 1321 AGCTGGAGTC ACTCAAATTA GAAAATCGTC ATCTTTCTGA AATGGTGATG AAATTGGAAT 1381 TGGGTTTACA TGAGTGTTCC TTGCCTGTAT CTCCCCTTGG TTCAATAGCT ACCAGATTTT 1441 TGGAAGAGGA GGAACTGAGG TCTCATCACA TTCTAGAGCG CTTGGATGCC CATATTGAAG 1501 AACTAAAAAG AGAGAGTGAA AAGACAGTGA GACAATTCAC AGCCTTAAAG TACCCAACTT 1561 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1621 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1681 CTTGTGGAAA GGACGAGTCT ACCCGGTGCT CGGTATTGGT ACGCGTTAAG TCgacaatca 1741 acctctggat tacaaaattt gtgaaagatt