Transcript: Human XM_024453773.1

PREDICTED: Homo sapiens centrosomal protein 63 (CEP63), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP63 (80254)
Length:
2791
CDS:
399..2426

Additional Resources:

NCBI RefSeq record:
XM_024453773.1
NBCI Gene record:
CEP63 (80254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330481 ACAAGCGTCGGATAGTATAAA pLKO_005 2063 CDS 100% 15.000 21.000 N CEP63 n/a
2 TRCN0000133672 GACTTCCTACTCTCTATGTAA pLKO.1 2150 CDS 100% 5.625 7.875 N CEP63 n/a
3 TRCN0000330384 GACTTCCTACTCTCTATGTAA pLKO_005 2150 CDS 100% 5.625 7.875 N CEP63 n/a
4 TRCN0000138771 GCTCAGCTTGTCAATCGGAAA pLKO.1 870 CDS 100% 4.050 5.670 N CEP63 n/a
5 TRCN0000330448 GCTCAGCTTGTCAATCGGAAA pLKO_005 870 CDS 100% 4.050 5.670 N CEP63 n/a
6 TRCN0000134542 GCTAGATACAAATGAAGCCAA pLKO.1 2192 CDS 100% 2.640 3.696 N CEP63 n/a
7 TRCN0000134421 GAGTTACTGTCATCTGAAGTA pLKO.1 2472 3UTR 100% 4.950 3.465 N CEP63 n/a
8 TRCN0000138034 GCAGCTCTTCAGTCTCAAGAA pLKO.1 1134 CDS 100% 4.950 3.465 N CEP63 n/a
9 TRCN0000330449 GCAGCTCTTCAGTCTCAAGAA pLKO_005 1134 CDS 100% 4.950 3.465 N CEP63 n/a
10 TRCN0000137247 GCTGGAGATTTCTACTCAGAT pLKO.1 1892 CDS 100% 4.950 3.465 N CEP63 n/a
11 TRCN0000134915 CTGAAGTAGCAGCTCTTTAAA pLKO.1 2485 3UTR 100% 15.000 9.000 N CEP63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04195 pDONR223 100% 66.4% 66.4% None 0_1ins84;844_981del;1383_1868del n/a
2 ccsbBroad304_04195 pLX_304 0% 66.4% 66.4% V5 0_1ins84;844_981del;1383_1868del n/a
3 TRCN0000466011 GTCTACCCGGTGCTCGGTATTGGT pLX_317 21.2% 66.4% 66.4% V5 0_1ins84;844_981del;1383_1868del n/a
Download CSV