Construct: ORF TRCN0000466045
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002325.1_s317c1
- Derived from:
- ccsbBroadEn_08539
- DNA Barcode:
- TTGGCCCTCATGACACCCTCCTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ASIC4 (55515)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466045
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55515 | ASIC4 | acid sensing ion channel su... | NM_182847.2 | 99.8% | 99.6% | 1847G>T;1856T>C |
| 2 | human | 55515 | ASIC4 | acid sensing ion channel su... | NM_018674.5 | 97% | 96.8% | 1399_1455del;1904G>T;1913T>C |
| 3 | human | 55515 | ASIC4 | acid sensing ion channel su... | XM_017004439.1 | 45% | 44.8% | (many diffs) |
| 4 | mouse | 241118 | Asic4 | acid-sensing (proton-gated)... | NM_183022.3 | 71.1% | 76.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2007
- ORF length:
- 1941
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gagcggagcg gctggggctg cgcggcgtgg cggagcagcg ctcgctccct 121 cgctcactcg ctcgctcgca gggacacacg caggggctga cagctgtgct ggtgctgata 181 agggaagcca caaggagacg atcgaggaga gagacaagcg gcagcagagg cagcagcggc 241 agaggcagca ccagggctgc ggagctgctg ggagtgggag tgactccccc acctcgggcc 301 cccaccctgt ccctgtcctc ttcccgcttg ccctgagttt agaagagcag ccgctgccac 361 cactgccact cgggagggca ccagggctgc tggctaggga gggacagggc agggaggctc 421 tggccagtcc cagcagccgg ggacagatgc cgatcgagat tgtgtgcaaa atcaaatttg 481 ctgaggagga tgcgaaaccc aaggagaagg aggcagggga tgagcagagc ctcctcgggg 541 ctgttgcccc tggagcagcc ccccgagacc tggccacctt tgccagcacc agcaccctgc 601 atggactggg ccgggcctgt ggcccaggcc cccacggact gcgcagaacc ctgtgggcac 661 tggccctact cacctcgctg gctgccttcc tgtaccaggc ggctggcctg gcccggggct 721 acctgacccg gcctcacctg gtggcaatgg accccgctgc cccagcccca gtggcgggct 781 tcccggctgt caccctctgc aatatcaacc gcttccggca ttcggcactc agcgatgccg 841 acatcttcca cctggccaat ctgacagggc tgccccccaa agaccgggat gggcaccgtg 901 cggctggcct gcgctaccca gagcctgaca tggtagacat cctcaaccgc actggccacc 961 agctcgccga catgcttaag agctgcaact tcagtgggca tcactgctcc gccagcaact 1021 tctctgtggt ctatactcgc tatgggaagt gttacacctt caacgcggac ccgcggagct 1081 cgctgcccag ccgggcaggg ggcatgggca gtggcctgga gatcatgctg gacatccagc 1141 aggaggagta cctgcccatc tggagggaga caaatgagac gtcgtttgag gcaggtattc 1201 gggtgcagat ccacagccag gaggagccgc cctacatcca ccagctgggg ttcggggtgt 1261 ccccaggctt ccagaccttt gtgtcctgcc aggaacagcg gctgacctac ctgccccagc 1321 cctggggcaa ctgccgcgca gagagtgagc tcagggagcc tgagcttcag ggctactcgg 1381 cctacagtgt gtctgcctgc cggctgcgct gtgaaaagga ggccgtgctt cagcgctgcc 1441 actgccggat ggtgcacatg ccagactccc tgggtggggg ccctgagggc ccgtgcttct 1501 gccccacccc ctgcaacctg acacgctatg ggaaagagat ctccatggtc aggatcccca 1561 acaggggctc agcccggtac ctggcgagga agtacaaccg caacgagacc tacatacggg 1621 agaacttcct ggtcctagat gtcttctttg aggccctgac ctctgaagcc atggagcagc 1681 gagcagccTA TGGCCTGTCA GCCCTGCTGG GAGACCTCGG GGGACAGATG GGCCTGTTCA 1741 TTGGGGCCAG CATCCTCACG TTGCTGGAGA TCCTCGACTA CATCTATGAG GTGTCCTGGG 1801 ATCGACTGAA GCGGGTATGG AGGCGTCCCA AGACCCCCCT GCGGACCTCC ACTGGGGGCA 1861 TCTCCACTTT GGGGCTTCAG GAGCTGAAGG AACAGAGTCC CTGCCCGAGC CTGGGCCGAG 1921 CGGAGGGTGG GGGGGTCAGC AGTCTGCTCC CCAATCACCA CCACCCCCAC GGTCCCCCAG 1981 GAGGTCTCTT TGAAGATTTT GCTTGCTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 2041 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2101 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTGGCCCT 2161 CATGACACCC TCCTCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2221 aagatt