Transcript: Human XM_017004439.1

PREDICTED: Homo sapiens acid sensing ion channel subunit family member 4 (ASIC4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASIC4 (55515)
Length:
1917
CDS:
229..1191

Additional Resources:

NCBI RefSeq record:
XM_017004439.1
NBCI Gene record:
ASIC4 (55515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420538 GACCATCTGCCCACCAAATAT pLKO_005 597 CDS 100% 15.000 21.000 N ASIC4 n/a
2 TRCN0000443972 CGTCGTTTGAGGCAGGTATTC pLKO_005 305 CDS 100% 10.800 15.120 N ASIC4 n/a
3 TRCN0000418989 GACAGATGGGCCTGTTCATTG pLKO_005 905 CDS 100% 10.800 7.560 N Asic4 n/a
4 TRCN0000432257 GAGACCATCTGCCCACCAAAT pLKO_005 595 CDS 100% 10.800 7.560 N Asic4 n/a
5 TRCN0000155199 GACACGCTATGGGAAAGAGAT pLKO.1 702 CDS 100% 4.950 3.465 N ASIC4 n/a
6 TRCN0000155307 GCTTTGCACAAAGGTCCTTCT pLKO.1 1346 3UTR 100% 4.050 2.835 N ASIC4 n/a
7 TRCN0000416736 ATGGGAAGTGTTACACCTTTA pLKO_005 167 5UTR 100% 10.800 7.560 N Asic4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15899 pDONR223 0% 84.9% 76.3% None (many diffs) n/a
2 ccsbBroad304_15899 pLX_304 0% 84.9% 76.3% V5 (many diffs) n/a
3 TRCN0000479137 ATACAGAATGTATTGCAATAAACT pLX_317 47% 84.9% 76.3% V5 (many diffs) n/a
4 ccsbBroadEn_08539 pDONR223 100% 45% 44.8% None (many diffs) n/a
5 ccsbBroad304_08539 pLX_304 0% 45% 44.8% V5 (many diffs) n/a
6 TRCN0000466045 TTGGCCCTCATGACACCCTCCTCA pLX_317 16.7% 45% 44.8% V5 (many diffs) n/a
Download CSV