Construct: ORF TRCN0000466119
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013639.1_s317c1
- Derived from:
- ccsbBroadEn_10302
- DNA Barcode:
- TTAAAGCTTTTAAGCAAGACCAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NCOR1P1 (149934)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466119
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 149934 | NCOR1P1 | nuclear receptor corepresso... | NR_003678.1 | 73% | 1_55del;362_419del | |
2 | human | 105379511 | LOC105379511 | nuclear receptor corepresso... | NR_135512.1 | 52.4% | (many diffs) | |
3 | human | 105379562 | LOC105379562 | uncharacterized LOC105379562 | XR_951438.2 | 36.4% | (many diffs) | |
4 | human | 105379562 | LOC105379562 | uncharacterized LOC105379562 | XR_951439.2 | 36.2% | (many diffs) | |
5 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | NM_001190438.1 | 10.4% | 9.8% | (many diffs) |
6 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_934337.2 | 8.1% | (many diffs) | |
7 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_429862.3 | 8.1% | (many diffs) | |
8 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_934336.2 | 8% | (many diffs) | |
9 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_934335.2 | 8% | (many diffs) | |
10 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_934334.2 | 7.9% | (many diffs) | |
11 | human | 101930665 | LOC101930665 | uncharacterized LOC101930665 | XR_934333.2 | 7.9% | (many diffs) | |
12 | human | 105372582 | LOC105372582 | uncharacterized LOC105372582 | NR_135006.1 | 7% | (many diffs) | |
13 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025420.2 | 4.1% | 3.8% | (many diffs) |
14 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | NM_001190440.1 | 4% | 3.8% | (many diffs) |
15 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_011524086.3 | 4% | 3.8% | (many diffs) |
16 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025419.2 | 4% | 3.8% | (many diffs) |
17 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025418.2 | 3.9% | 3.7% | (many diffs) |
18 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_011524085.3 | 3.9% | 3.7% | (many diffs) |
19 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | NM_006311.4 | 3.9% | 3.6% | (many diffs) |
20 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256875.4 | 3.9% | 3.6% | (many diffs) |
21 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025417.2 | 3.9% | 3.6% | (many diffs) |
22 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_006721604.4 | 3.8% | 3.6% | (many diffs) |
23 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025416.2 | 3.8% | 3.6% | (many diffs) |
24 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025415.2 | 3.8% | 3.6% | (many diffs) |
25 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256874.5 | 3.8% | 3.6% | (many diffs) |
26 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256873.5 | 3.8% | 3.5% | (many diffs) |
27 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_006721603.4 | 3.8% | 3.5% | (many diffs) |
28 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256872.5 | 3.8% | 3.5% | (many diffs) |
29 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025409.2 | 3.8% | 3.5% | (many diffs) |
30 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025410.2 | 3.8% | 3.5% | (many diffs) |
31 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025411.2 | 3.8% | 3.5% | (many diffs) |
32 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025412.2 | 3.8% | 3.5% | (many diffs) |
33 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025413.2 | 3.8% | 3.5% | (many diffs) |
34 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025414.2 | 3.8% | 3.5% | (many diffs) |
35 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_024451043.1 | 3.8% | 3.5% | (many diffs) |
36 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256871.5 | 3.8% | 3.5% | (many diffs) |
37 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025403.2 | 3.8% | 3.5% | (many diffs) |
38 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025404.2 | 3.8% | 3.5% | (many diffs) |
39 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025405.2 | 3.8% | 3.5% | (many diffs) |
40 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025406.2 | 3.8% | 3.5% | (many diffs) |
41 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025407.2 | 3.8% | 3.5% | (many diffs) |
42 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025408.2 | 3.8% | 3.5% | (many diffs) |
43 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_024451042.1 | 3.8% | 3.5% | (many diffs) |
44 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256868.5 | 3.7% | 3.5% | (many diffs) |
45 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_006721602.4 | 3.7% | 3.5% | (many diffs) |
46 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_011524084.3 | 3.7% | 3.5% | (many diffs) |
47 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025400.2 | 3.7% | 3.5% | (many diffs) |
48 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025401.2 | 3.7% | 3.5% | (many diffs) |
49 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025402.2 | 3.7% | 3.5% | (many diffs) |
50 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_024451041.1 | 3.7% | 3.5% | (many diffs) |
51 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_005256866.5 | 3.7% | 3.5% | (many diffs) |
52 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_006721601.4 | 3.7% | 3.5% | (many diffs) |
53 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_011524083.3 | 3.7% | 3.5% | (many diffs) |
54 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025396.2 | 3.7% | 3.5% | (many diffs) |
55 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025397.2 | 3.7% | 3.5% | (many diffs) |
56 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025398.2 | 3.7% | 3.5% | (many diffs) |
57 | human | 9611 | NCOR1 | nuclear receptor corepressor 1 | XM_017025399.2 | 3.7% | 3.5% | (many diffs) |
58 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | NM_177229.3 | 31% | 29.8% | (many diffs) |
59 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314391.1 | 4% | 3.8% | (many diffs) |
60 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532628.3 | 3.8% | 3.7% | (many diffs) |
61 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314390.1 | 3.8% | 3.6% | (many diffs) |
62 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314389.1 | 3.8% | 3.6% | (many diffs) |
63 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314388.1 | 3.8% | 3.6% | (many diffs) |
64 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314387.1 | 3.8% | 3.6% | (many diffs) |
65 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | NM_011308.3 | 3.7% | 3.6% | (many diffs) |
66 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532627.3 | 3.7% | 3.6% | (many diffs) |
67 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314386.1 | 3.7% | 3.6% | (many diffs) |
68 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532626.3 | 3.7% | 3.6% | (many diffs) |
69 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314385.1 | 3.7% | 3.6% | (many diffs) |
70 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314384.1 | 3.7% | 3.6% | (many diffs) |
71 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314383.1 | 3.7% | 3.6% | (many diffs) |
72 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314382.1 | 3.7% | 3.5% | (many diffs) |
73 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314381.1 | 3.7% | 3.5% | (many diffs) |
74 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314380.1 | 3.7% | 3.5% | (many diffs) |
75 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314379.1 | 3.7% | 3.5% | (many diffs) |
76 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532625.3 | 3.7% | 3.5% | (many diffs) |
77 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | NM_001252313.1 | 3.6% | 3.5% | (many diffs) |
78 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532624.3 | 3.6% | 3.5% | (many diffs) |
79 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532623.3 | 3.6% | 3.5% | (many diffs) |
80 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314378.1 | 3.6% | 3.5% | (many diffs) |
81 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314377.1 | 3.6% | 3.5% | (many diffs) |
82 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314375.1 | 3.6% | 3.5% | (many diffs) |
83 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314376.1 | 3.6% | 3.5% | (many diffs) |
84 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314374.1 | 3.6% | 3.5% | (many diffs) |
85 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314373.1 | 3.6% | 3.5% | (many diffs) |
86 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314372.1 | 3.6% | 3.5% | (many diffs) |
87 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314371.1 | 3.6% | 3.5% | (many diffs) |
88 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532621.3 | 3.6% | 3.5% | (many diffs) |
89 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314370.1 | 3.6% | 3.5% | (many diffs) |
90 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314368.1 | 3.6% | 3.4% | (many diffs) |
91 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314369.1 | 3.6% | 3.4% | (many diffs) |
92 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314367.1 | 3.6% | 3.4% | (many diffs) |
93 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314366.1 | 3.6% | 3.4% | (many diffs) |
94 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532620.3 | 3.6% | 3.4% | (many diffs) |
95 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314365.1 | 3.6% | 3.4% | (many diffs) |
96 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532619.3 | 3.5% | 3.4% | (many diffs) |
97 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314364.1 | 3.5% | 3.4% | (many diffs) |
98 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314362.1 | 3.5% | 3.4% | (many diffs) |
99 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314363.1 | 3.5% | 3.4% | (many diffs) |
100 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532618.3 | 3.5% | 3.4% | (many diffs) |
101 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314361.1 | 3.5% | 3.4% | (many diffs) |
102 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314360.1 | 3.5% | 3.4% | (many diffs) |
103 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314359.1 | 3.5% | 3.4% | (many diffs) |
104 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532613.3 | 3.5% | 3.4% | (many diffs) |
105 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532614.3 | 3.5% | 3.4% | (many diffs) |
106 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532615.3 | 3.5% | 3.4% | (many diffs) |
107 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_006532616.3 | 3.5% | 3.4% | (many diffs) |
108 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314356.1 | 3.5% | 3.4% | (many diffs) |
109 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314357.1 | 3.5% | 3.4% | (many diffs) |
110 | mouse | 20185 | Ncor1 | nuclear receptor co-repress... | XM_017314358.1 | 3.5% | 3.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 375
- ORF length:
- 306
- Sequence:
-
1 TCTTCCATTT CAGGTGTCGT GAGGCTAGCA TCGATTGATC AACAAGTTTG TACAAAAAAG 61 TTGGCACCAT GTCAAGTTCA GGTTACCCTC CCAACCAAGG AGCATTCAGC ACAGAACAAA 121 GTCATTATCC TCCTCACTCT GTAAAGTATA CGTTTCCCAG CACCCACCAC CAGCAGGATC 181 CAGCATTTGG AGGCAAACAT GAAGCTCCAT CCTCTCCAAT TCTGGGGCAA CCGTGTGGAG 241 ATGATCAAAA TGCTTCACCT TCAAAACTTT CAAAGGAAGA GTTAATAGAG TGTATGGATC 301 GTGTAGATCG AGAAATTGCA AAAGTAGAAC AGCAGATCCT TAAACTGAAA AAGAAACAAG 361 TAAAAGTCTT CGTCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 421 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 481 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TTAAAGCTTT TAAGCAAGAC 541 CAGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt