Construct: ORF TRCN0000466167
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011556.1_s317c1
- Derived from:
- ccsbBroadEn_02930
- DNA Barcode:
- CACCCGTGCCAGAATGCAGCTCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PITPNC1 (26207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466167
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | NM_181671.3 | 100% | 100% | |
| 2 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | XM_017024443.1 | 94.5% | 94.7% | (many diffs) |
| 3 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | XM_017024444.1 | 91.4% | 91.4% | 0_1ins69 |
| 4 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | XM_017024445.1 | 91.4% | 91.4% | 0_1ins69 |
| 5 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | NM_012417.4 | 77.5% | 72.7% | (many diffs) |
| 6 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | XM_017024442.1 | 73.2% | 68.5% | (many diffs) |
| 7 | human | 26207 | PITPNC1 | phosphatidylinositol transf... | XM_005257216.2 | 70.6% | 65.8% | (many diffs) |
| 8 | mouse | 71795 | Pitpnc1 | phosphatidylinositol transf... | NM_145823.2 | 90.2% | 98.1% | (many diffs) |
| 9 | mouse | 71795 | Pitpnc1 | phosphatidylinositol transf... | XM_006534264.3 | 82.4% | 89.5% | (many diffs) |
| 10 | mouse | 71795 | Pitpnc1 | phosphatidylinositol transf... | XM_006534262.3 | 69.9% | 71.8% | (many diffs) |
| 11 | mouse | 71795 | Pitpnc1 | phosphatidylinositol transf... | XM_006534263.3 | 63.6% | 64.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 870
- ORF length:
- 804
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggtatgct gctgaaagag taccggatct gcatgccgct caccgtagac gagtacaaaa 121 ttggacagct gtacatgatc agcaaacaca gccatgaaca gagtgaccgg ggagaagggg 181 tggaggtcgt ccagaatgag ccctttgagg accctcacca tggcaatggg cagttcaccg 241 agaagcgggt gtatctcaac agcaaactgc ctagttgggc tagagctgtt gtccccaaaa 301 tattttatgt gacagagaag gcttggaact attatcccta cacaattaca gaatacacat 361 gttcctttct gccgaaattc tccattcata tagaaaccaa gtatgaggac aacaaaggaa 421 gcaatgacac cattttcgac aatgaagcca aagacgtgga gagagaagtt tgctttattg 481 atattgcctg cgatgaaatt ccagagcgct actacaaaga atctgaggat ccTAAGCACT 541 TCAAGTCAGA GAAGACAGGA CGGGGACAGT TGAGGGAAGG CTGGAGAGAT AGTCATCAGC 601 CTATCATGTG CTCCTACAAG CTGGTGACTG TGAAGTTTGA GGTCTGGGGG CTTCAGACCA 661 GAGTGGAACA ATTTGTACAC AAGGTGGTCC GAGACATTCT GCTGATTGGA CATAGACAGG 721 CTTTTGCATG GGTTGATGAG TGGTATGATA TGACAATGGA TGATGTTCGG GAATACGAGA 781 AAAACATGCA TGAACAAACC AACATAAAAG TTTGCAATCA GCATTCCTCC CCTGTGGATG 841 ACATAGAGAG TCATGCCCAA ACAAGTACAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 901 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 961 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACACCC 1021 GTGCCAGAAT GCAGCTCACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1081 tgaaagatt