Transcript: Mouse XM_006534264.3

PREDICTED: Mus musculus phosphatidylinositol transfer protein, cytoplasmic 1 (Pitpnc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pitpnc1 (71795)
Length:
1180
CDS:
117..854

Additional Resources:

NCBI RefSeq record:
XM_006534264.3
NBCI Gene record:
Pitpnc1 (71795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100613 GTCCGAGACATCTTGCTGATT pLKO.1 669 CDS 100% 4.950 6.930 N Pitpnc1 n/a
2 TRCN0000287934 GTCCGAGACATCTTGCTGATT pLKO_005 669 CDS 100% 4.950 6.930 N Pitpnc1 n/a
3 TRCN0000295364 GCATGAACAAACCAACATAAA pLKO_005 770 CDS 100% 13.200 9.240 N Pitpnc1 n/a
4 TRCN0000100614 CAGCTGTATATGATCAGCAAA pLKO.1 108 5UTR 100% 4.950 3.465 N Pitpnc1 n/a
5 TRCN0000100612 CCGAAATTCTCCATCCACATA pLKO.1 354 CDS 100% 4.950 3.465 N Pitpnc1 n/a
6 TRCN0000100610 GCGCCAGAATTTCTGTCCATT pLKO.1 1016 3UTR 100% 4.950 3.465 N Pitpnc1 n/a
7 TRCN0000288012 GCGCCAGAATTTCTGTCCATT pLKO_005 1016 3UTR 100% 4.950 3.465 N Pitpnc1 n/a
8 TRCN0000100611 GCCGAAATTCTCCATCCACAT pLKO.1 353 CDS 100% 4.050 2.835 N Pitpnc1 n/a
9 TRCN0000287935 GCCGAAATTCTCCATCCACAT pLKO_005 353 CDS 100% 4.050 2.835 N Pitpnc1 n/a
10 TRCN0000295427 GACCGAGAAGGCGTGGAATTA pLKO_005 293 CDS 100% 13.200 7.920 N Pitpnc1 n/a
11 TRCN0000271633 ACAAGGTGGTCCGAGACATTC pLKO_005 661 CDS 100% 10.800 15.120 N PITPNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02930 pDONR223 100% 82.4% 89.5% None (many diffs) n/a
2 ccsbBroad304_02930 pLX_304 0% 82.4% 89.5% V5 (many diffs) n/a
3 TRCN0000466167 CACCCGTGCCAGAATGCAGCTCAC pLX_317 42.2% 82.4% 89.5% V5 (many diffs) n/a
Download CSV