Transcript: Human XM_017024444.1

PREDICTED: Homo sapiens phosphatidylinositol transfer protein cytoplasmic 1 (PITPNC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PITPNC1 (26207)
Length:
5463
CDS:
446..1183

Additional Resources:

NCBI RefSeq record:
XM_017024444.1
NBCI Gene record:
PITPNC1 (26207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281757 ATAAGCCATGTCGGCCCAAAT pLKO_005 1466 3UTR 100% 10.800 15.120 N PITPNC1 n/a
2 TRCN0000059480 CGAATTTCTGTCCGTTCCCAA pLKO.1 1350 3UTR 100% 2.640 3.696 N PITPNC1 n/a
3 TRCN0000059478 GCCGAAATTCTCCATTCATAT pLKO.1 682 CDS 100% 13.200 10.560 N PITPNC1 n/a
4 TRCN0000059479 CGGGTGTATCTCAACAGCAAA pLKO.1 557 CDS 100% 4.950 3.960 N PITPNC1 n/a
5 TRCN0000281811 ACTATTATCCCTACACAATTA pLKO_005 639 CDS 100% 13.200 9.240 N PITPNC1 n/a
6 TRCN0000295364 GCATGAACAAACCAACATAAA pLKO_005 1099 CDS 100% 13.200 9.240 N Pitpnc1 n/a
7 TRCN0000271589 TGATATTGCCTGCGATGAAAT pLKO_005 790 CDS 100% 13.200 9.240 N PITPNC1 n/a
8 TRCN0000271633 ACAAGGTGGTCCGAGACATTC pLKO_005 990 CDS 100% 10.800 7.560 N PITPNC1 n/a
9 TRCN0000271588 ATACTCTCAGGCATAACATAC pLKO_005 1894 3UTR 100% 10.800 7.560 N PITPNC1 n/a
10 TRCN0000059481 CAATGGATGAAGTCCGAGAAT pLKO.1 1184 CDS 100% 4.950 3.465 N PITPNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02930 pDONR223 100% 91.4% 91.4% None 0_1ins69 n/a
2 ccsbBroad304_02930 pLX_304 0% 91.4% 91.4% V5 0_1ins69 n/a
3 TRCN0000466167 CACCCGTGCCAGAATGCAGCTCAC pLX_317 42.2% 91.4% 91.4% V5 0_1ins69 n/a
Download CSV