Construct: ORF TRCN0000466175
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011265.3_s317c1
- Derived from:
- ccsbBroadEn_07680
- DNA Barcode:
- GTCCTATTGGTAATCCGACCGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NEK6 (10783)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466175
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166168.1 | 99.8% | 100% | 697C>T |
| 2 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166170.1 | 99.8% | 100% | 697C>T |
| 3 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_014397.5 | 99.8% | 100% | 697C>T |
| 4 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_005251664.1 | 99.8% | 100% | 697C>T |
| 5 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_006716936.2 | 99.8% | 100% | 697C>T |
| 6 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447386.1 | 99.8% | 100% | 697C>T |
| 7 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447387.1 | 99.8% | 100% | 697C>T |
| 8 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166167.1 | 94.4% | 94.5% | 1_54del;751C>T |
| 9 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166169.1 | 92.5% | 92.6% | 1_75del;772C>T |
| 10 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001145001.2 | 90.1% | 90.2% | 1_102del;799C>T |
| 11 | human | 10783 | NEK6 | NIMA related kinase 6 | NM_001166171.1 | 90.1% | 90.2% | 1_102del;799C>T |
| 12 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_017014217.1 | 90.1% | 90.2% | 1_102del;799C>T |
| 13 | human | 10783 | NEK6 | NIMA related kinase 6 | XM_024447385.1 | 84.2% | 84.3% | 1_174del;871C>T |
| 14 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_001159631.1 | 88.7% | 95.2% | (many diffs) |
| 15 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | NM_021606.3 | 88.7% | 95.2% | (many diffs) |
| 16 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498210.3 | 88.7% | 95.2% | (many diffs) |
| 17 | mouse | 59126 | Nek6 | NIMA (never in mitosis gene... | XM_006498209.3 | 77.5% | 83.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1005
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aggacagccc ggccacatgc cccatggagg gagttccaac aacctctgcc 121 acaccctggg gcctgtgcat cctcctgacc cacagaggca tcccaacacg ctgtcttttc 181 gctgctcgct ggcggacttc cagatcgaaa agaagatagg ccgaggacag ttcagcgagg 241 tgtacaaggc cacctgcctg ctggacagga agacagtggc tctgaagaag gtgcagatct 301 ttgagatgat ggacgccaag gcgaggcagg actgtgtcaa ggagatcggc ctcttgaagc 361 aactgaacca cccaaatatc atcaagtatt tggactcgtt tatcgaagac aacgagctga 421 acattgtgct ggagttggct gacgcagggg acctctcgca gatgatcaag tactttaaga 481 agcagaagcg gctcatcccg gagaggacag tatggaagta ctttgtgcag ctgtgcagcg 541 ccgtggagca catgcattca cgccgggtga tgcaccgaga catcaagcct gccaacgtgt 601 tcatcacagc cacgggcgtc gtgaagctcg gtgaccttgg tctgggccgc ttcttcagct 661 ctgagaccac cgcagcccac tccctagtgg ggacgcccTA CTACATGTCA CCGGAGAGGA 721 TCCATGAGAA CGGCTACAAC TTCAAGTCCG ACATCTGGTC CTTGGGCTGT CTGCTGTACG 781 AGATGGCAGC CCTCCAGAGC CCCTTCTATG GAGATAAGAT GAATCTCTTC TCCCTGTGCC 841 AGAAGATCGA GCAGTGTGAC TACCCCCCAC TCCCCGGGGA GCACTACTCC GAGAAGTTAC 901 GAGAACTGGT CAGCATGTGC ATCTGCCCTG ACCCCCACCA GAGACCTGAC ATCGGATACG 961 TGCACCAGGT GGCCAAGCAG ATGCACATCT GGATGTCCAG CACCTGCCCA ACTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA GTCCTATTGG TAATCCGACC GCCAACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt