Transcript: Mouse NM_021606.3

Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 6 (Nek6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nek6 (59126)
Length:
3168
CDS:
127..1068

Additional Resources:

NCBI RefSeq record:
NM_021606.3
NBCI Gene record:
Nek6 (59126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274721 GAGTAGAGATTGCGCTAATAT pLKO_005 1503 3UTR 100% 15.000 21.000 N Nek6 n/a
2 TRCN0000026958 CCCGAGAGAATCCATGAGAAT pLKO.1 772 CDS 100% 4.950 3.960 N Nek6 n/a
3 TRCN0000339089 AGAGTAGAGATTGCGCTAATA pLKO_005 1502 3UTR 100% 13.200 9.240 N Nek6 n/a
4 TRCN0000027021 CACCGACCTGACATTGTATAT pLKO.1 1000 CDS 100% 13.200 9.240 N Nek6 n/a
5 TRCN0000274724 CACCGACCTGACATTGTATAT pLKO_005 1000 CDS 100% 13.200 9.240 N Nek6 n/a
6 TRCN0000274784 TCTCACAGATGATCAAGTATT pLKO_005 515 CDS 100% 13.200 9.240 N Nek6 n/a
7 TRCN0000026973 AGGACAGTTCAGTGAGGTTTA pLKO.1 285 CDS 100% 10.800 7.560 N Nek6 n/a
8 TRCN0000274723 AGGACAGTTCAGTGAGGTTTA pLKO_005 285 CDS 100% 10.800 7.560 N Nek6 n/a
9 TRCN0000027030 CCATCCGAATATCATCAAGTA pLKO.1 429 CDS 100% 4.950 3.465 N Nek6 n/a
10 TRCN0000323427 CCATCCGAATATCATCAAGTA pLKO_005 429 CDS 100% 4.950 3.465 N Nek6 n/a
11 TRCN0000195418 CCCTTCTATGGAGATAAGATG pLKO.1 862 CDS 100% 4.950 3.465 N NEK6 n/a
12 TRCN0000197247 GCAGATCTTTGAGATGATGGA pLKO.1 354 CDS 100% 2.640 1.848 N NEK6 n/a
13 TRCN0000026997 TGGAGATAAGATGAATCTCTT pLKO.1 870 CDS 100% 0.495 0.347 N Nek6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07680 pDONR223 100% 88.7% 95.2% None (many diffs) n/a
2 ccsbBroad304_07680 pLX_304 0% 88.7% 95.2% V5 (many diffs) n/a
3 TRCN0000466175 GTCCTATTGGTAATCCGACCGCCA pLX_317 33% 88.7% 95.2% V5 (many diffs) n/a
4 ccsbBroadEn_14978 pDONR223 0% 88.7% 95.2% None (many diffs) n/a
5 ccsbBroad304_14978 pLX_304 0% 88.7% 95.2% V5 (many diffs) n/a
6 TRCN0000474711 GTCACCATGCAAATGTTCTAGCCT pLX_317 54.1% 88.7% 95.2% V5 (many diffs) n/a
7 TRCN0000488038 CGTTAATCCACCCTCACTAATGAT pLX_317 33% 88.7% 95.2% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488514 TCACTTTACTTCTAACTGCTTCAT pLX_317 34.3% 88.6% 94.9% V5 (many diffs) n/a
9 TRCN0000488684 CACCCATTAGTAAGCCAGTTGCCC pLX_317 33.7% 86.5% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV