Transcript: Human XM_024447385.1

PREDICTED: Homo sapiens NIMA related kinase 6 (NEK6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEK6 (10783)
Length:
2919
CDS:
309..1424

Additional Resources:

NCBI RefSeq record:
XM_024447385.1
NBCI Gene record:
NEK6 (10783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001726 GCAACTTCCTAGCGTGACTTT pLKO.1 2225 3UTR 100% 4.950 6.930 N NEK6 n/a
2 TRCN0000219695 AGCACTACTCCGAGAAGTTAC pLKO.1 1297 CDS 100% 10.800 8.640 N NEK6 n/a
3 TRCN0000001727 GCAACTGAACCACCCAAATAT pLKO.1 776 CDS 100% 15.000 10.500 N NEK6 n/a
4 TRCN0000219694 GCAGATGATCAAGTACTTTAA pLKO.1 875 CDS 100% 13.200 9.240 N NEK6 n/a
5 TRCN0000195418 CCCTTCTATGGAGATAAGATG pLKO.1 1218 CDS 100% 4.950 3.465 N NEK6 n/a
6 TRCN0000001725 CGAAGACAACGAGCTGAACAT pLKO.1 821 CDS 100% 4.950 3.465 N NEK6 n/a
7 TRCN0000001724 GAACCACCCAAATATCATCAA pLKO.1 782 CDS 100% 4.950 3.465 N NEK6 n/a
8 TRCN0000197247 GCAGATCTTTGAGATGATGGA pLKO.1 710 CDS 100% 2.640 1.848 N NEK6 n/a
9 TRCN0000001723 CCCGGAGAGGACAGTATGGAA pLKO.1 914 CDS 100% 1.000 0.700 N NEK6 n/a
10 TRCN0000026997 TGGAGATAAGATGAATCTCTT pLKO.1 1226 CDS 100% 0.495 0.347 N Nek6 n/a
11 TRCN0000195191 CCTTATTTCTTGTTCCCAAAC pLKO.1 2499 3UTR 100% 6.000 3.600 N NEK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447385.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07680 pDONR223 100% 84.2% 84.3% None 1_174del;871C>T n/a
2 ccsbBroad304_07680 pLX_304 0% 84.2% 84.3% V5 1_174del;871C>T n/a
3 TRCN0000466175 GTCCTATTGGTAATCCGACCGCCA pLX_317 33% 84.2% 84.3% V5 1_174del;871C>T n/a
4 ccsbBroadEn_14978 pDONR223 0% 84.2% 84.3% None 1_174del;871C>T n/a
5 ccsbBroad304_14978 pLX_304 0% 84.2% 84.3% V5 1_174del;871C>T n/a
6 TRCN0000474711 GTCACCATGCAAATGTTCTAGCCT pLX_317 54.1% 84.2% 84.3% V5 1_174del;871C>T n/a
7 TRCN0000488038 CGTTAATCCACCCTCACTAATGAT pLX_317 33% 84.2% 84.3% V5 (not translated due to prior stop codon) 1_174del;871C>T n/a
8 TRCN0000488514 TCACTTTACTTCTAACTGCTTCAT pLX_317 34.3% 84.2% 84.1% V5 1_174del;871C>T;1113_1114insG n/a
9 TRCN0000488684 CACCCATTAGTAAGCCAGTTGCCC pLX_317 33.7% 82.3% 82.4% V5 (not translated due to prior stop codon) 1_195del;871C>T n/a
Download CSV