Transcript: Human NM_001145001.2

Homo sapiens NIMA related kinase 6 (NEK6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NEK6 (10783)
Length:
2810
CDS:
262..1305

Additional Resources:

NCBI RefSeq record:
NM_001145001.2
NBCI Gene record:
NEK6 (10783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148151 GCAGCGAAAAGACAGCGTGT pXPR_003 TGG 205 20% 4 0.3498 NEK6 NEK6 76258
2 BRDN0001144960 TCACGCCGGGTGATGCACCG pXPR_003 AGG 611 59% 7 0.2688 NEK6 NEK6 76257
3 BRDN0001147000 TCACCTTGATCATCTGCGAG pXPR_003 AGG 494 47% 6 -0.2947 NEK6 NEK6 76256
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001726 GCAACTTCCTAGCGTGACTTT pLKO.1 2106 3UTR 100% 4.950 6.930 N NEK6 n/a
2 TRCN0000219695 AGCACTACTCCGAGAAGTTAC pLKO.1 1178 CDS 100% 10.800 8.640 N NEK6 n/a
3 TRCN0000001727 GCAACTGAACCACCCAAATAT pLKO.1 657 CDS 100% 15.000 10.500 N NEK6 n/a
4 TRCN0000219694 GCAGATGATCAAGTACTTTAA pLKO.1 756 CDS 100% 13.200 9.240 N NEK6 n/a
5 TRCN0000195418 CCCTTCTATGGAGATAAGATG pLKO.1 1099 CDS 100% 4.950 3.465 N NEK6 n/a
6 TRCN0000001725 CGAAGACAACGAGCTGAACAT pLKO.1 702 CDS 100% 4.950 3.465 N NEK6 n/a
7 TRCN0000001724 GAACCACCCAAATATCATCAA pLKO.1 663 CDS 100% 4.950 3.465 N NEK6 n/a
8 TRCN0000197247 GCAGATCTTTGAGATGATGGA pLKO.1 591 CDS 100% 2.640 1.848 N NEK6 n/a
9 TRCN0000001723 CCCGGAGAGGACAGTATGGAA pLKO.1 795 CDS 100% 1.000 0.700 N NEK6 n/a
10 TRCN0000026997 TGGAGATAAGATGAATCTCTT pLKO.1 1107 CDS 100% 0.495 0.347 N Nek6 n/a
11 TRCN0000195191 CCTTATTTCTTGTTCCCAAAC pLKO.1 2380 3UTR 100% 6.000 3.600 N NEK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07680 pDONR223 100% 90.1% 90.2% None 1_102del;799C>T n/a
2 ccsbBroad304_07680 pLX_304 0% 90.1% 90.2% V5 1_102del;799C>T n/a
3 TRCN0000466175 GTCCTATTGGTAATCCGACCGCCA pLX_317 33% 90.1% 90.2% V5 1_102del;799C>T n/a
4 ccsbBroadEn_14978 pDONR223 0% 90.1% 90.2% None 1_102del;799C>T n/a
5 ccsbBroad304_14978 pLX_304 0% 90.1% 90.2% V5 1_102del;799C>T n/a
6 TRCN0000474711 GTCACCATGCAAATGTTCTAGCCT pLX_317 54.1% 90.1% 90.2% V5 1_102del;799C>T n/a
7 TRCN0000488038 CGTTAATCCACCCTCACTAATGAT pLX_317 33% 90.1% 90.2% V5 (not translated due to prior stop codon) 1_102del;799C>T n/a
8 TRCN0000488514 TCACTTTACTTCTAACTGCTTCAT pLX_317 34.3% 90% 89.9% V5 1_102del;799C>T;1041_1042insG n/a
9 TRCN0000488684 CACCCATTAGTAAGCCAGTTGCCC pLX_317 33.7% 88% 88.1% V5 (not translated due to prior stop codon) 1_123del;799C>T n/a
Download CSV