Construct: ORF TRCN0000466186
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016627.1_s317c1
- Derived from:
- ccsbBroadEn_02823
- DNA Barcode:
- GTGGGGAATAAAGAACGGCAATAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SSBP3 (23648)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466186
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23648 | SSBP3 | single stranded DNA binding... | NM_145716.4 | 100% | 100% | |
2 | human | 23648 | SSBP3 | single stranded DNA binding... | NM_018070.5 | 94.8% | 94.8% | 444_445ins60 |
3 | human | 23648 | SSBP3 | single stranded DNA binding... | NM_001009955.4 | 93% | 93% | 362_363ins81 |
4 | human | 23648 | SSBP3 | single stranded DNA binding... | XM_006710545.4 | 87.8% | 87.8% | 363_364ins141 |
5 | human | 23648 | SSBP3 | single stranded DNA binding... | XM_017000897.2 | 71.6% | 71.6% | 0_1ins330 |
6 | human | 23648 | SSBP3 | single stranded DNA binding... | XM_017000898.2 | 71.6% | 71.6% | 0_1ins330 |
7 | human | 23648 | SSBP3 | single stranded DNA binding... | XM_017000899.2 | 64.6% | 64.6% | 0_1ins330;32_33ins81 |
8 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | NM_023672.2 | 95.3% | 100% | (many diffs) |
9 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503413.2 | 93.4% | 97.9% | (many diffs) |
10 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503412.2 | 92% | 96.5% | (many diffs) |
11 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503411.2 | 90.2% | 94.6% | (many diffs) |
12 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | NM_198438.1 | 88.4% | 93% | (many diffs) |
13 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503416.2 | 86.7% | 91.1% | (many diffs) |
14 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503415.2 | 85.4% | 89.8% | (many diffs) |
15 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503414.2 | 83.7% | 88% | (many diffs) |
16 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503419.2 | 67.8% | 71.6% | (many diffs) |
17 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503417.3 | 64.2% | 67.8% | (many diffs) |
18 | mouse | 72475 | Ssbp3 | single-stranded DNA binding... | XM_006503420.2 | 57.7% | 61.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1230
- ORF length:
- 1164
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tgccaaaggc aaaggctcgg cggtgccctc ggatgggcag gctcgggaaa 121 agttagcttt atacgtctac gaatatttac tgcacgtagg agcacagaaa tctgcacaga 181 ccttcttatc ggagattcga tgggaaaaaa acatcacgtt gggagaaccg cctgggtttt 241 tgcactcgtg gtggtgtgta ttttgggacc tttactgtgc agctcctgaa aggagagaca 301 cttgtgaaca ttcaagtgaa gcaaaagcct ttcatgatta tagtgcagca gctgccccga 361 gccccgtgct tggcaacatt ccccccaacg atgggatgcc gggaggcccc atcccgccag 421 gtttctttca gggtcctccg gggtcacagc cctcgccgca cgcacagcct ccacctcaca 481 atcctagcag catgatggga ccccacagtc agccttttat gtcaccgcga tacgcaggcg 541 gccccaggcc cccgatcaga atgggaaacc agcctccggg aggagttcct gggacacagc 601 cattgctgcc caattctatg gatcccacac gacaacaagg ccaccccaac atgggaggat 661 caatgcagag aatgaaccct ccccgaggca tggggcccat gggtcccggc ccacagaatt 721 acggcagcgg catgagacca ccacccaact ccctcggccc cgccatgccc gggattaaca 781 tgggcccggg agctggcaga ccctggccca atcctaacag tgctaactca attccatact 841 cctcctcatc acctggtacc tatgtgggac cccctggtgg tggcggTCCT CCAGGAACAC 901 CCATTATGCC CAGTCCCGCA GATTCAACAA ATTCCAGTGA CAACATCTAC ACAATGATTA 961 ATCCAGTGCC GCCTGGAGGC AGCCGGTCCA ACTTCCCGAT GGGTCCCGGC TCGGACGGTC 1021 CGATGGGCGG CATGGGTGGC ATGGAGCCAC ACCACATGAA TGGATCATTA GGGTCAGGCG 1081 ACATAGACGG ACTTCCAAAA AATTCTCCTA ACAACATAAG TGGCATTAGC AATCCTCCAG 1141 GCACCCCTCG AGATGACGGC GAGCTAGGAG GGAACTTCCT CCACTCCTTT CAGAACGACA 1201 ATTATTCTCC AAGCATGACG ATGAGTGTGT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1261 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1321 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGTGGG 1381 GAATAAAGAA CGGCAATATA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1441 tgaaagatt