Transcript: Human NM_145716.4

Homo sapiens single stranded DNA binding protein 3 (SSBP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SSBP3 (23648)
Length:
3252
CDS:
387..1553

Additional Resources:

NCBI RefSeq record:
NM_145716.4
NBCI Gene record:
SSBP3 (23648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084367 AGCTTTATACGTCTACGAATA pLKO.1 446 CDS 100% 10.800 15.120 N Ssbp3 n/a
2 TRCN0000288081 AGCTTTATACGTCTACGAATA pLKO_005 446 CDS 100% 10.800 15.120 N Ssbp3 n/a
3 TRCN0000016298 GACAACATCTACACAATGATT pLKO.1 1260 CDS 100% 5.625 4.500 N SSBP3 n/a
4 TRCN0000423911 TTTCAAGTCAGTGACCAGAAA pLKO_005 1790 3UTR 100% 4.950 3.960 N SSBP3 n/a
5 TRCN0000016302 GCTTTATACGTCTACGAATAT pLKO.1 447 CDS 100% 13.200 9.240 N SSBP3 n/a
6 TRCN0000016300 TCCTCCAGGAACACCCATTAT pLKO.1 1208 CDS 100% 13.200 9.240 N SSBP3 n/a
7 TRCN0000434181 ACTGCACGTAGGAGCACAGAA pLKO_005 470 CDS 100% 4.950 3.465 N SSBP3 n/a
8 TRCN0000412878 CCTGAAAGGAGAGACACTTGT pLKO_005 606 CDS 100% 4.950 3.465 N SSBP3 n/a
9 TRCN0000016299 CCTAACAACATAAGTGGCATT pLKO.1 1428 CDS 100% 4.050 2.835 N SSBP3 n/a
10 TRCN0000016301 CGACAATTATTCTCCAAGCAT pLKO.1 1517 CDS 100% 3.000 2.100 N SSBP3 n/a
11 TRCN0000426046 GAGCACAGAAATCTGCACAGA pLKO_005 481 CDS 100% 2.640 1.848 N SSBP3 n/a
12 TRCN0000434095 TGTCATTATCCAGGAGCTGGT pLKO_005 1629 3UTR 100% 2.160 1.512 N SSBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02823 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02823 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466186 GTGGGGAATAAAGAACGGCAATAT pLX_317 29.8% 100% 100% V5 n/a
4 ccsbBroadEn_02824 pDONR223 98.5% 94.8% 94.8% None 445_504del n/a
5 ccsbBroad304_02824 pLX_304 0% 94.8% 94.8% V5 (not translated due to prior stop codon) 445_504del n/a
6 ccsbBroadEn_14092 pDONR223 100% 52.4% 1% None 1_552del;559delC n/a
7 ccsbBroad304_14092 pLX_304 0% 52.4% 1% V5 (not translated due to prior stop codon) 1_552del;559delC n/a
8 TRCN0000474142 ACATGGTAAGTTCTGCATGAAACC pLX_317 77.1% 52.4% 1% V5 (not translated due to prior stop codon) 1_552del;559delC n/a
Download CSV