Transcript: Mouse NM_198438.1

Mus musculus single-stranded DNA binding protein 3 (Ssbp3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ssbp3 (72475)
Length:
3130
CDS:
388..1473

Additional Resources:

NCBI RefSeq record:
NM_198438.1
NBCI Gene record:
Ssbp3 (72475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016302 GCTTTATACGTCTACGAATAT pLKO.1 448 CDS 100% 13.200 18.480 N SSBP3 n/a
2 TRCN0000084367 AGCTTTATACGTCTACGAATA pLKO.1 447 CDS 100% 10.800 15.120 N Ssbp3 n/a
3 TRCN0000288081 AGCTTTATACGTCTACGAATA pLKO_005 447 CDS 100% 10.800 15.120 N Ssbp3 n/a
4 TRCN0000084364 CGACAATTATTCTCCGAGCAT pLKO.1 1437 CDS 100% 2.640 2.112 N Ssbp3 n/a
5 TRCN0000288079 CGACAATTATTCTCCGAGCAT pLKO_005 1437 CDS 100% 2.640 2.112 N Ssbp3 n/a
6 TRCN0000307559 CAGAAGATGCCAAGAATTATG pLKO_005 1508 3UTR 100% 13.200 9.240 N Ssbp3 n/a
7 TRCN0000434181 ACTGCACGTAGGAGCACAGAA pLKO_005 471 CDS 100% 4.950 3.465 N SSBP3 n/a
8 TRCN0000412878 CCTGAAAGGAGAGACACTTGT pLKO_005 607 CDS 100% 4.950 3.465 N SSBP3 n/a
9 TRCN0000016299 CCTAACAACATAAGTGGCATT pLKO.1 1348 CDS 100% 4.050 2.835 N SSBP3 n/a
10 TRCN0000084365 CCTTCTTATCAGAGATTCGAT pLKO.1 503 CDS 100% 3.000 2.100 N Ssbp3 n/a
11 TRCN0000288080 CCTTCTTATCAGAGATTCGAT pLKO_005 503 CDS 100% 3.000 2.100 N Ssbp3 n/a
12 TRCN0000426046 GAGCACAGAAATCTGCACAGA pLKO_005 482 CDS 100% 2.640 1.848 N SSBP3 n/a
13 TRCN0000084363 GCAACCAAACAGACACTGTTT pLKO.1 2678 3UTR 100% 0.495 0.347 N Ssbp3 n/a
14 TRCN0000084366 CTCCTTCCAGAACGACAATTA pLKO.1 1425 CDS 100% 13.200 7.920 N Ssbp3 n/a
15 TRCN0000288156 CTCCTTCCAGAACGACAATTA pLKO_005 1425 CDS 100% 13.200 7.920 N Ssbp3 n/a
16 TRCN0000016298 GACAACATCTACACAATGATT pLKO.1 1180 CDS 100% 5.625 3.375 N SSBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198438.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02824 pDONR223 98.5% 91.1% 94.5% None (many diffs) n/a
2 ccsbBroad304_02824 pLX_304 0% 91.1% 94.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_02823 pDONR223 100% 88.4% 93% None (many diffs) n/a
4 ccsbBroad304_02823 pLX_304 0% 88.4% 93% V5 (many diffs) n/a
5 TRCN0000466186 GTGGGGAATAAAGAACGGCAATAT pLX_317 29.8% 88.4% 93% V5 (many diffs) n/a
6 ccsbBroadEn_14092 pDONR223 100% 52.9% 1.1% None (many diffs) n/a
7 ccsbBroad304_14092 pLX_304 0% 52.9% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000474142 ACATGGTAAGTTCTGCATGAAACC pLX_317 77.1% 52.9% 1.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV