Construct: ORF TRCN0000466330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013809.1_s317c1
- Derived from:
- ccsbBroadEn_02126
- DNA Barcode:
- TCACCGTCTCGAGAAGACCACTGA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDLIM7 (9260)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_213636.2 | 100% | 100% | |
2 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_005451.5 | 46.1% | 43% | (many diffs) |
3 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NM_203352.3 | 38.5% | 34.6% | (many diffs) |
4 | human | 9260 | PDLIM7 | PDZ and LIM domain 7 | NR_103804.2 | 32.7% | (many diffs) | |
5 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | NM_001114087.2 | 88.6% | 93.2% | (many diffs) |
6 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | NM_026131.4 | 75.6% | 78.8% | (many diffs) |
7 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | XM_006517349.1 | 72% | 62.6% | (many diffs) |
8 | mouse | 67399 | Pdlim7 | PDZ and LIM domain 7 | NR_104287.1 | 57.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ttccttcaaa gtagtgctgg aggggccagc accttggggc ttccggctgc 121 aagggggcaa ggacttcaat gtgcccctct ccatttcccg gctcactcct gggggcaaag 181 cggcgcaggc cggagtggcc gtgggtgact gggtgctgag catcgatggc gagaatgcgg 241 gtagcctcac acacatcgaa gctcagaaca agatccgggc ctgcggggag cgcctcagcc 301 tgggcctcag cagggcccag ccggttcaga gcaaaccgca gaaggcctcc gcccccgccg 361 cggacccTCC GCGGTACACC TTTGCACCCA GCGTCTCCCT CAACAAGACG GCCCGGCCCT 421 TTGGGGCGCC CCCGCCCGCT GACAGCGCCC CGCAGCAGAA TGGACAGCCG CTCCGACCGC 481 TGGTCCCAGA TGCCAGCAAG CAGCGGCTGA TGGAGAACAC AGAGGACTGG CGGCCGCGGC 541 CGGGGACAGG CCAGTCGCGT TCCTTCCGCA TCCTTGCCCA CCTCACAGGC ACCGAGTTCA 601 TGCAAGACCC GGATGAGGAG CACCTGAAGA AATCAAGGGA AAAGTATGTC CTGGAGCTGC 661 AGAGCCCACG CTACACCCGC CTCCGGGACT GGCACCACCA GCGCTCTGCC CACGTGCTCA 721 ACGTGCAGTC GACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA 781 CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC 841 GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATCAC CGTCTCGAGA AGACCACTGA 901 ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt