Transcript: Human NM_213636.2

Homo sapiens PDZ and LIM domain 7 (PDLIM7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PDLIM7 (9260)
Length:
1027
CDS:
90..758

Additional Resources:

NCBI RefSeq record:
NM_213636.2
NBCI Gene record:
PDLIM7 (9260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165446 GATGAGGAGCACCTGAAGAAA pLKO.1 636 CDS 100% 5.625 3.938 N PDLIM7 n/a
2 TRCN0000323381 GATGAGGAGCACCTGAAGAAA pLKO_005 636 CDS 100% 5.625 3.938 N PDLIM7 n/a
3 TRCN0000323299 TGAGCATCGATGGCGAGAATG pLKO_005 241 CDS 100% 10.800 6.480 N PDLIM7 n/a
4 TRCN0000375191 GTTCATGCAAGACCCGGATGA pLKO_005 620 CDS 100% 4.050 2.430 N Pdlim7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213636.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02126 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02126 pLX_304 0% 100% 100% V5 (not translated due to frame shift) n/a
3 TRCN0000466330 TCACCGTCTCGAGAAGACCACTGA pLX_317 54.5% 100% 100% V5 (not translated due to frame shift) n/a
4 ccsbBroadEn_11354 pDONR223 100% 85.7% 85.1% None 413C>A;573_666delinsC n/a
5 ccsbBroad304_11354 pLX_304 0% 85.7% 85.1% V5 413C>A;573_666delinsC n/a
6 TRCN0000472937 ACAAGGGCGCAACGTACTCCCCAT pLX_317 57.8% 85.7% 85.1% V5 413C>A;573_666delinsC n/a
7 ccsbBroadEn_02125 pDONR223 100% 46.1% 43% None (many diffs) n/a
8 ccsbBroad304_02125 pLX_304 0% 46.1% 43% V5 (many diffs) n/a
9 TRCN0000474842 GCGCCAGGTAGACTTACACACAGT pLX_317 37.3% 46.1% 43% V5 (many diffs) n/a
Download CSV