Construct: ORF TRCN0000466342
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011673.1_s317c1
- Derived from:
- ccsbBroadEn_00568
- DNA Barcode:
- ATGTCCCGGCCCCCCTTAATCACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FHL2 (2274)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466342
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001039492.3 | 100% | 100% | |
| 2 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318894.1 | 100% | 100% | |
| 3 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318895.3 | 100% | 100% | |
| 4 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318896.2 | 100% | 100% | |
| 5 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001374399.1 | 100% | 100% | |
| 6 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001450.4 | 100% | 100% | |
| 7 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_201555.2 | 100% | 100% | |
| 8 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_201557.4 | 100% | 100% | |
| 9 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318899.2 | 61.2% | 61.2% | 0_1ins324 |
| 10 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318897.2 | 59.1% | 59.1% | 0_1ins342 |
| 11 | human | 2274 | FHL2 | four and a half LIM domains 2 | NM_001318898.2 | 59.1% | 59.1% | 0_1ins342 |
| 12 | mouse | 14200 | Fhl2 | four and a half LIM domains 2 | NM_001289533.1 | 87.2% | 92.1% | (many diffs) |
| 13 | mouse | 14200 | Fhl2 | four and a half LIM domains 2 | NM_010212.4 | 87.2% | 92.1% | (many diffs) |
| 14 | mouse | 14200 | Fhl2 | four and a half LIM domains 2 | XM_011238434.2 | 87.2% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 903
- ORF length:
- 837
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tgagcgcttt gactgccacc attgcaacga atctctcttt ggcaagaagt 121 acatcctgcg ggaggagagc ccctactgcg tggtgtgctt tgagaccctg ttcgccaaca 181 cctgcgagga gtgtgggaag cccatcggct gtgactgcaa ggacttgtct tacaaggacc 241 ggcactggca tgaagcctgt ttccactgct cgcagtgcag aaactcactg gtggacaagc 301 cctttgctgc caaggaggac cagctgctct gtacagactg ctattccaac gagtactcat 361 ccaagtgcca ggaatgcaag aagaccatca tgccaggtac ccgcaagatg gagtacaagg 421 gcagcagctg gcatgagacc tgcttcatct gccaccgctg ccagcagcca attggaacca 481 agagtttcat ccccaaagac aatcagaatt tctgtgtgcc cTGCTATGAG AAACAACATG 541 CCATGCAGTG CGTTCAGTGC AAAAAGCCCA TCACCACGGG AGGGGTCACT TACCGGGAGC 601 AGCCCTGGCA CAAGGAGTGC TTCGTGTGCA CCGCCTGCAG GAAGCAGCTG TCTGGGCAGC 661 GCTTCACAGC TCGCGATGAC TTTGCCTACT GCCTGAACTG CTTCTGTGAC TTGTATGCCA 721 AGAAGTGTGC TGGGTGCACC AACCCCATCA GCGGACTTGG TGGCACAAAA TACATCTCCT 781 TTGAGGAACG GCAGTGGCAT AACGACTGCT TTAACTGTAA GAAGTGCTCC CTCTCACTGG 841 TGGGGCGTGG CTTCCTCACA GAGAGGGACG ACATCCTGTG CCCCGACTGT GGGAAAGACA 901 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 961 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1021 GGCTTTATAT ATCTTGTGGA AAGGACGAAT GTCCCGGCCC CCCTTAATCA CAACGCGTTA 1081 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt