Transcript: Human NM_001318894.1

Homo sapiens four and a half LIM domains 2 (FHL2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
FHL2 (2274)
Length:
1798
CDS:
471..1310

Additional Resources:

NCBI RefSeq record:
NM_001318894.1
NBCI Gene record:
FHL2 (2274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005773 CGACTGCTTTAACTGTAAGAA pLKO.1 1208 CDS 100% 5.625 7.875 N FHL2 n/a
2 TRCN0000273528 CGACTGCTTTAACTGTAAGAA pLKO_005 1208 CDS 100% 5.625 7.875 N FHL2 n/a
3 TRCN0000005772 CCCTGCTATGAGAAACAACAT pLKO.1 924 CDS 100% 4.950 6.930 N FHL2 n/a
4 TRCN0000285011 CCCAAAGACAATCAGAATTTC pLKO_005 897 CDS 100% 13.200 9.240 N FHL2 n/a
5 TRCN0000285010 CCAATTGGAACCAAGAGTTTC pLKO_005 873 CDS 100% 10.800 7.560 N FHL2 n/a
6 TRCN0000005774 CGAATCTCTCTTTGGCAAGAA pLKO.1 503 CDS 100% 4.950 3.465 N FHL2 n/a
7 TRCN0000273585 CGAATCTCTCTTTGGCAAGAA pLKO_005 503 CDS 100% 4.950 3.465 N FHL2 n/a
8 TRCN0000005771 GAGACTTTCTTCTAGTGCTTT pLKO.1 1412 3UTR 100% 4.950 3.465 N FHL2 n/a
9 TRCN0000273529 GAGACTTTCTTCTAGTGCTTT pLKO_005 1412 3UTR 100% 4.950 3.465 N FHL2 n/a
10 TRCN0000005775 CCAGGAATGCAAGAAGACCAT pLKO.1 773 CDS 100% 2.640 1.848 N FHL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00568 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00568 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466342 ATGTCCCGGCCCCCCTTAATCACA pLX_317 45.7% 100% 100% V5 n/a
Download CSV