Construct: ORF TRCN0000466345
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000743.1_s317c1
- Derived from:
- ccsbBroadEn_07716
- DNA Barcode:
- CGCAGGAGGCATCCGCAAAATCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB40B (10966)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466345
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | NM_006822.3 | 99.8% | 99.6% | 124C>A |
| 2 | human | 282808 | RAB40AL | RAB40A like | NM_001031834.1 | 90.2% | 88.4% | (many diffs) |
| 3 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_011523528.2 | 89.3% | 85.9% | (many diffs) |
| 4 | human | 142684 | RAB40A | RAB40A, member RAS oncogene... | NM_080879.3 | 89.2% | 87.7% | (many diffs) |
| 5 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_006722271.3 | 85.2% | 83% | (many diffs) |
| 6 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_005256334.4 | 77.6% | 75% | (many diffs) |
| 7 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_017024042.1 | 77.6% | 75% | (many diffs) |
| 8 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_017024043.1 | 77.6% | 75% | (many diffs) |
| 9 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_024450550.1 | 77.6% | 75% | (many diffs) |
| 10 | human | 10966 | RAB40B | RAB40B, member RAS oncogene... | XM_024450551.1 | 77.6% | 75% | (many diffs) |
| 11 | mouse | 217371 | Rab40b | Rab40B, member RAS oncogene... | NM_139147.3 | 86.9% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 900
- ORF length:
- 834
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgccctgggc agcccggtcc gggcctacga ctttctgctc aagttcctgc 121 tggtgggcga cagcgacgtg ggcaagggcg agatcctggc gagcctgcag gatggcgcgg 181 ccgagtccac gtacggccac ccggcgggca tcgactacaa gacgaccacc atcctgctgg 241 acgggcggcg ggtgaagctg cagctctggg atacttcagg ccagggaaga ttttgtacca 301 tattccgctc ctactcccgg ggcgcacagg gtgtgatcct ggtctatgac attgcgaacc 361 gctggtcttt tgacggcatt gatcgatgga ttaaggagat cgatgagcat gcccccggag 421 tccccaagat cctggtgggg aaccgcctgc acctggcgtt caagcggcag gtgcccacgg 481 agcaggccca ggcctacgcc gagcgcctgg gcgtgacctt ctttgaggtc agccctctgt 541 gcaatttcaa catcacagag tcgttcacgg agctggccag gatcgtgctg ctgcggcatg 601 ggatggaccg gctctggcgg ccgagcaagg tgctgagctt gcaagacctc tgctgccggg 661 cggtcgtgtc ctgcacgccg gtgcacctgg tggacaagct cccgctcccc attgccttaa 721 gaagccacct caagtccttc tcgatggcca acggcctgaa tgccaggatg atgcacggcg 781 gttcctactc cctcaccacc agctccaccc acaaaaggag cagcctccgc aaagtgaagc 841 tcgTCCGCCC CCCCCAGAGC CCCCCCAAAA ACTGCACCAG AAACAGCTGC AAAATTTCTT 901 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 961 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1021 TTTATATATC TTGTGGAAAG GACGACGCAG GAGGCATCCG CAAAATCTAA CGCGTTAAGT 1081 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt