Transcript: Mouse NM_139147.3

Mus musculus Rab40B, member RAS oncogene family (Rab40b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab40b (217371)
Length:
1865
CDS:
110..949

Additional Resources:

NCBI RefSeq record:
NM_139147.3
NBCI Gene record:
Rab40b (217371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102769 GTGGTCCTGGTCTATGACATT pLKO.1 380 CDS 100% 4.950 6.930 N Rab40b n/a
2 TRCN0000102765 GCATTTATTAACGGTAACGAT pLKO.1 1158 3UTR 100% 3.000 4.200 N Rab40b n/a
3 TRCN0000380151 TGTACCATATTCCGCTCATAC pLKO_005 341 CDS 100% 10.800 8.640 N Rab40b n/a
4 TRCN0000382341 TAGATGGCCGAAGGGTGAAAC pLKO_005 285 CDS 100% 10.800 7.560 N Rab40b n/a
5 TRCN0000102766 CGATGGATTAAGGAGATTGAT pLKO.1 431 CDS 100% 5.625 3.938 N Rab40b n/a
6 TRCN0000102767 CCACCTTAAGTCTTTCTCGAT pLKO.1 772 CDS 100% 2.640 1.848 N Rab40b n/a
7 TRCN0000102768 CTTCAACATTACAGAGTCCTT pLKO.1 592 CDS 100% 2.640 1.848 N Rab40b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139147.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07716 pDONR223 100% 86.9% 92.1% None (many diffs) n/a
2 ccsbBroad304_07716 pLX_304 0% 86.9% 92.1% V5 (many diffs) n/a
3 TRCN0000466345 CGCAGGAGGCATCCGCAAAATCTA pLX_317 7.8% 86.9% 92.1% V5 (many diffs) n/a
Download CSV