Construct: ORF TRCN0000466402
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009154.1_s317c1
- Derived from:
- ccsbBroadEn_04491
- DNA Barcode:
- CGCATTGTGCCTACTAGATGATTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAV1 (89796)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466402
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 89796 | NAV1 | neuron navigator 1 | XM_006711611.2 | 40.3% | 40.3% | 1_2478del |
| 2 | human | 89796 | NAV1 | neuron navigator 1 | XM_017002752.1 | 37.8% | 37.8% | 1_2748del |
| 3 | human | 89796 | NAV1 | neuron navigator 1 | XM_006711610.2 | 37.8% | 37.8% | 1_2757del |
| 4 | human | 89796 | NAV1 | neuron navigator 1 | NM_001167738.2 | 37.6% | 37.6% | 1_2772del |
| 5 | human | 89796 | NAV1 | neuron navigator 1 | XM_006711609.2 | 37.6% | 37.6% | 1_2781del |
| 6 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510102.2 | 30.9% | 30.9% | 1_3750del |
| 7 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510101.2 | 30.8% | 30.8% | 1_3759del |
| 8 | human | 89796 | NAV1 | neuron navigator 1 | XM_017002751.2 | 30.7% | 30.7% | 1_3774del |
| 9 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510100.2 | 30.7% | 30.7% | 1_3783del |
| 10 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510099.2 | 29.9% | 29.9% | 1_3921del |
| 11 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510098.2 | 29.9% | 29.9% | 1_3930del |
| 12 | human | 89796 | NAV1 | neuron navigator 1 | XM_011510097.2 | 29.8% | 29.8% | 1_3945del |
| 13 | human | 89796 | NAV1 | neuron navigator 1 | NM_020443.4 | 29.7% | 29.7% | 1_3954del |
| 14 | human | 89796 | NAV1 | neuron navigator 1 | XM_024450645.1 | 29.4% | 29.4% | 1_4023del |
| 15 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529380.3 | 34.4% | 36.8% | (many diffs) |
| 16 | mouse | 215690 | Nav1 | neuron navigator 1 | NM_173437.2 | 27.1% | 29.1% | (many diffs) |
| 17 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529379.3 | 26.9% | 28.9% | (many diffs) |
| 18 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529378.3 | 26.7% | 28.6% | (many diffs) |
| 19 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529377.3 | 24.1% | 25.8% | (many diffs) |
| 20 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529376.3 | 24% | 25.8% | (many diffs) |
| 21 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529375.3 | 24% | 25.7% | (many diffs) |
| 22 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529374.3 | 23.6% | 25.3% | (many diffs) |
| 23 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_017319809.1 | 23.6% | 25.3% | (many diffs) |
| 24 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529373.3 | 23.5% | 25.2% | (many diffs) |
| 25 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529372.3 | 23.5% | 25.1% | (many diffs) |
| 26 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529371.3 | 23.4% | 25.1% | (many diffs) |
| 27 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529369.3 | 23.4% | 25.1% | (many diffs) |
| 28 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_006529370.3 | 23.4% | 25.1% | (many diffs) |
| 29 | mouse | 215690 | Nav1 | neuron navigator 1 | XM_017319805.1 | 23.4% | 25.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1743
- ORF length:
- 1677
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gcttacagac atccgcttgg aggccctcaa ctctgcccac caactggatc 121 agcttcggga gaccatgcac aacatgcagt tggaggtgga cctgctgaaa gcagagaatg 181 accgactgaa ggtagcccca ggcccctcat caggctccac tccagggcag gtccctggat 241 catctgcatt atcttcccca cgccgctccc taggcctggc actcacccat tccttcggcc 301 ccagtcttgc agacacagac ctgtcaccca tggatggcat cagtacttgt ggtccaaagg 361 aggaagtgac cctccgggtg gtggtgagga tgcccccgca gcacatcatc aaaggggact 421 tgaagcagca ggaattcttc ctgggctgta gcaaggtcag tggaaaagtt gactggaaga 481 tgctggatga agctgttttc caagtgttca aggactatat ttctaaaatg gacccagcct 541 ctaccctggg actaagcact gagtccatcc atggctacag catcagccac gtgaaacgag 601 tgttggatgc agagcccccc gagatgcctc cttgccgtcg aggtgtcaat aacatatcag 661 tctccctcaa aggtctgaag gagaaatgcg tcgacagcct ggtgttcgag acgctgatcc 721 ccaagccgat gatgcagcac tacataagcc tcctgctgaa gcaccggcgc ctcgtcctct 781 cgggccccag cggcacgggc aagacctacc tgaccaatcg cttggccgag tacctggtgg 841 agcgctctgg ccgtgaggtc acagagggca tcgtcagcac cttcaacatg caccagcagt 901 cttgcaagga tctgcaactg tatctttcca acctagccaa ccagatagac cgggaaacag 961 gaattgggga tgtgcccctg gtgattctat tggatgacct gagtgaagca ggctccatca 1021 gtgagttggt caatggggcc ctcacctgca agtatcataa atgtccctat attataggta 1081 ccaccaatca gcctgtaaaa atgacaccca accatggctt gcacttgagc ttcaggatgt 1141 tgaccttctc caacaacgtg gagccagcca atggcttcct ggttcgttac ctgaggagga 1201 agctggtaga gtcagacagc gacatcaatg ccaacaagga agagctgctt cgggtgctcg 1261 actgggtacc caagctgtgg tatcatctcc acaccttcct tgagaagcac agcacctcag 1321 acttcctcat cggcccttgc ttctttctgt cgtgtcccat tGGCATTGAG GACTTCCGGA 1381 CCTGGTTCAT TGACCTGTGG AACAACTCTA TCATTCCCTA TCTACAGGAA GGAGCCAAGG 1441 ATGGGATAAA GGTCCATGGA CAGAAAGCTG CTTGGGAGGA CCCAGTGGAA TGGGTCCGGG 1501 ACACACTTCC CTGGCCATCA GCCCAACAAG ACCAATCAAA GCTGTACCAC CTGCCCCCAC 1561 CCACCGTGGG CCCTCACAGC ATTGCCTCAC CTCCCGAGGA TAGGACAGTC AAAGACAGCA 1621 CCCCAAGTTC TCTGGACTCA GATCCTCTGA TGGCCATGCT GCTGAAACTT CAAGAAGCTG 1681 CCAACTACAT TGAGTCTCCA GATCGAGAAA CCATCCTGGA CCCCAACCTT CAGGCAACAC 1741 TTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1801 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1861 GGCTTTATAT ATCTTGTGGA AAGGACGACG CATTGTGCCT ACTAGATGAT TTACGCGTTA 1921 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt