Transcript: Human XM_017002751.2

PREDICTED: Homo sapiens neuron navigator 1 (NAV1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAV1 (89796)
Length:
12494
CDS:
4..5457

Additional Resources:

NCBI RefSeq record:
XM_017002751.2
NBCI Gene record:
NAV1 (89796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424669 TCTCGCAGGAACTCAACAATA pLKO_005 1345 CDS 100% 13.200 18.480 N NAV1 n/a
2 TRCN0000147229 GCACTGACTAAGCTAAAGTTA pLKO.1 9720 3UTR 100% 5.625 7.875 N NAV1 n/a
3 TRCN0000148345 CGCAAGACTAGCTTAGATGTT pLKO.1 1936 CDS 100% 4.950 6.930 N NAV1 n/a
4 TRCN0000150020 CTTCAACAAAGCGTTCAGTAT pLKO.1 3483 CDS 100% 4.950 6.930 N NAV1 n/a
5 TRCN0000130833 GCTTCCTCATACTCGGATATA pLKO.1 3523 CDS 100% 13.200 10.560 N NAV1 n/a
6 TRCN0000128104 CCACATAGAAACCCTGCATTT pLKO.1 9483 3UTR 100% 10.800 8.640 N NAV1 n/a
7 TRCN0000427489 CAACAAAGCGTTCAGTATAAA pLKO_005 3486 CDS 100% 15.000 10.500 N NAV1 n/a
8 TRCN0000148860 CCCTGGTTTCTCATTCCTTAA pLKO.1 10267 3UTR 100% 10.800 7.560 N NAV1 n/a
9 TRCN0000148460 CCTGTGGAACAACTCTATCAT pLKO.1 5106 CDS 100% 5.625 3.938 N NAV1 n/a
10 TRCN0000125410 CCTGGAGCTAATGAGTGGTTT pLKO.1 2580 CDS 100% 4.950 3.465 N Nav1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7058 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 11444 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 11444 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002751.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04491 pDONR223 100% 30.7% 30.7% None 1_3774del n/a
2 ccsbBroad304_04491 pLX_304 0% 30.7% 30.7% V5 1_3774del n/a
3 TRCN0000466402 CGCATTGTGCCTACTAGATGATTT pLX_317 23% 30.7% 30.7% V5 1_3774del n/a
Download CSV