Transcript: Mouse XM_006529377.3

PREDICTED: Mus musculus neuron navigator 1 (Nav1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nav1 (215690)
Length:
13938
CDS:
510..6842

Additional Resources:

NCBI RefSeq record:
XM_006529377.3
NBCI Gene record:
Nav1 (215690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125413 GCCGAGGTGTCAATAACATAT pLKO.1 5734 CDS 100% 13.200 18.480 N Nav1 n/a
2 TRCN0000125412 CGGTAAGCGATGATGGCAAAT pLKO.1 1993 CDS 100% 10.800 15.120 N Nav1 n/a
3 TRCN0000125410 CCTGGAGCTAATGAGTGGTTT pLKO.1 3989 CDS 100% 4.950 3.960 N Nav1 n/a
4 TRCN0000125409 CGGAAGATATAAACAGACAAA pLKO.1 7168 3UTR 100% 4.950 3.465 N Nav1 n/a
5 TRCN0000125411 CCTGTGGAACAATTCCATCAT pLKO.1 6491 CDS 100% 4.950 2.970 N Nav1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04491 pDONR223 100% 24.1% 25.8% None (many diffs) n/a
2 ccsbBroad304_04491 pLX_304 0% 24.1% 25.8% V5 (many diffs) n/a
3 TRCN0000466402 CGCATTGTGCCTACTAGATGATTT pLX_317 23% 24.1% 25.8% V5 (many diffs) n/a
Download CSV