Construct: ORF TRCN0000466439
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016907.2_s317c1
- Derived from:
- ccsbBroadEn_14732
- DNA Barcode:
- TTTGATTTCATTTCTTTCGAACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK18 (5129)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466439
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_002596.4 | 99.5% | 99.3% | 1_6delATGATC;497C>T |
| 2 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_212502.3 | 99.5% | 99.3% | 1_6delATGATC;497C>T |
| 3 | human | 5129 | CDK18 | cyclin dependent kinase 18 | NM_212503.3 | 93.5% | 93.4% | 1_6delATGATC;274_363del;587C>T |
| 4 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XM_011509602.3 | 87% | 86.9% | 1_210del;701C>T |
| 5 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XM_017001423.2 | 82.4% | 82.3% | 1_210del;478_567del;791C>T |
| 6 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_002956776.1 | 38.6% | (many diffs) | |
| 7 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426781.4 | 38.1% | (many diffs) | |
| 8 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426784.3 | 37.9% | (many diffs) | |
| 9 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426782.4 | 37.6% | (many diffs) | |
| 10 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_001737213.1 | 36.8% | (many diffs) | |
| 11 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426780.4 | 36.7% | (many diffs) | |
| 12 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_426779.3 | 35.9% | (many diffs) | |
| 13 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_921822.3 | 35.8% | (many diffs) | |
| 14 | human | 5129 | CDK18 | cyclin dependent kinase 18 | XR_001737212.2 | 35% | (many diffs) | |
| 15 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | NM_008795.2 | 85.2% | 87% | (many diffs) |
| 16 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XM_011247940.2 | 71.5% | 73.7% | (many diffs) |
| 17 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XR_001783189.1 | 35.6% | (many diffs) | |
| 18 | mouse | 18557 | Cdk18 | cyclin-dependent kinase 18 | XR_387152.3 | 33.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1482
- ORF length:
- 1416
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caagatgaag aactttaagc gccgtttctc cctgtcagtg ccccgcactg 121 agaccattga agaatccttg gctgaattca cggagcaatt caaccagctc cacaaccggc 181 ggaatgagaa cttgcagctc ggtcctcttg gcagagaccc cccgcaggag tgcagcacct 241 tctccccaac agacagcggg gaggagccgg ggcagctctc ccctggcgtg cagttccagc 301 ggcggcagaa ccagcgccgc ttctccatgg aggacgtcag caagaggctc tctctgccca 361 tggatatccg cctgccccag gaattcctac agaagctaca gatggagagc ccagatctgc 421 ccaagccgct cagccgcatg tcccgccggg cctccctgtc agacattggc tttgggaaac 481 tggaaacata cgtgaaactg gacaaactgg gagagggcac ctatgccaca gtcttcaaag 541 ggcgcagcaa actgatggag aaccttgtgg ccctgaaaga gatccggctg gagcacgagg 601 agggagcgcc ctgcactgcc atccgagagg tgtctctgct gaagaacctg aagcacgcca 661 atattgtgac cctgcatgac ctcatccaca cagatcggtc cctcaccctg gtgtttgagt 721 acctggacag tgacctgaag cagtatctgg accactgtgg gaacctcatg agcatgcaca 781 acgtcaagat tttcatgttc cagctgctcc ggggcctcgc ctactgtcac caccgcaaga 841 tcctgcaccg ggacctgaag ccccagaacc tgctcatcaa cgagaggggg gagctgaagc 901 tggccgactt tggactggcc agggccaagt cagtgcccac aaagacttac tccaatgagg 961 tggtgaccct gtggtacagg ccccccgatg tgctgctggg atccacagag tactccaccc 1021 ccattgatat gtggggcgtg ggctgcatcc actacgagat ggccacaggg aggcccctct 1081 tcccgggctc cacagtcaag gaggagctgc acctcatctt tcgcctcctc gggaccccca 1141 cagaagagac gtggcccggc gtgaccgccT TCTCTGAGTT CCGCACCTAC AGCTTCCCCT 1201 GCTACCTCCC GCAGCCGCTC ATCAACCACG CGCCCAGGTT GGATACGGAT GGCATCCACC 1261 TCCTGAGCAG CCTGCTCCTG TATGAATCCA AGAGTCGCAT GTCAGCAGAG GCTGCCCTGA 1321 GTCACTCCTA CTTCCGGTCT CTGGGAGAGC GTGTGCACCA GCTTGAAGAC ACTGCCTCCA 1381 TCTTCTCCCT GAAGGAGATC CAGCTCCAGA AGGACCCAGG CTACCGAGGC TTGGCCTTCC 1441 AGCAGCCAGG ACGAGGGAAG AACAGGCGGC AGAGCATCTT CTGCCCAACT TTCTTGTACA 1501 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1561 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1621 AGGACGATTT GATTTCATTT CTTTCGAACA AACGCGTTAA GTCgacaatc aacctctgga 1681 ttacaaaatt tgtgaaagat t