Transcript: Mouse NM_008795.2

Mus musculus cyclin-dependent kinase 18 (Cdk18), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cdk18 (18557)
Length:
3061
CDS:
302..1657

Additional Resources:

NCBI RefSeq record:
NM_008795.2
NBCI Gene record:
Cdk18 (18557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023214 CCCTCTGAGAACGAGGAATAT pLKO.1 2048 3UTR 100% 13.200 18.480 N Cdk18 n/a
2 TRCN0000350624 TGACGTCCATCTCTGAGTTTC pLKO_005 1335 CDS 100% 10.800 8.640 N Cdk18 n/a
3 TRCN0000321314 ACATGCACAATGTCAAGATAT pLKO_005 945 CDS 100% 13.200 9.240 N Cdk18 n/a
4 TRCN0000023218 AGGACCTGAAACACGCCAATA pLKO.1 816 CDS 100% 10.800 7.560 N Cdk18 n/a
5 TRCN0000321244 AGGACCTGAAACACGCCAATA pLKO_005 816 CDS 100% 10.800 7.560 N Cdk18 n/a
6 TRCN0000321247 AGTGCCTACAAAGACCTATTC pLKO_005 1105 CDS 100% 10.800 7.560 N Cdk18 n/a
7 TRCN0000321313 GCAGCCCTGTTGGTAGCATTT pLKO_005 1790 3UTR 100% 10.800 7.560 N Cdk18 n/a
8 TRCN0000023217 GCACAATGTCAAGATATTCAT pLKO.1 949 CDS 100% 5.625 3.938 N Cdk18 n/a
9 TRCN0000023216 GCAGTATCAACAACGGCAGAA pLKO.1 463 CDS 100% 4.050 2.835 N Cdk18 n/a
10 TRCN0000023215 GCCTACAAAGACCTATTCCAA pLKO.1 1108 CDS 100% 3.000 2.100 N Cdk18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14732 pDONR223 0% 85.2% 87% None (many diffs) n/a
2 ccsbBroad304_14732 pLX_304 0% 85.2% 87% V5 (many diffs) n/a
3 TRCN0000466439 TTTGATTTCATTTCTTTCGAACAA pLX_317 22.4% 85.2% 87% V5 (many diffs) n/a
4 TRCN0000488438 TGGGCAGAAAGGATGCTTCTAAAC pLX_317 22.5% 85.2% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_10440 pDONR223 100% 85% 86.6% None (many diffs) n/a
6 ccsbBroad304_10440 pLX_304 0% 85% 86.6% V5 (many diffs) n/a
7 TRCN0000467401 ATTCAGTCAAGCCTAAACTATCTA pLX_317 26.3% 85% 86.6% V5 (many diffs) n/a
8 TRCN0000491649 GGCGACGAAAAACCGGATATGAGT pLX_317 14.6% 54.7% 70.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV