Transcript: Human NM_001350214.2

Homo sapiens tubulin tyrosine ligase like 7 (TTLL7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TTLL7 (79739)
Length:
8005
CDS:
404..3067

Additional Resources:

NCBI RefSeq record:
NM_001350214.2
NBCI Gene record:
TTLL7 (79739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158427 CCTCTGGATTATACCTTTGTT pLKO.1 767 CDS 100% 5.625 7.875 N TTLL7 n/a
2 TRCN0000353691 CCTCTGGATTATACCTTTGTT pLKO_005 767 CDS 100% 5.625 7.875 N TTLL7 n/a
3 TRCN0000136641 GCGAATGGGTACAGAGAAGTA pLKO.1 1081 CDS 100% 4.950 6.930 N TTLL7 n/a
4 TRCN0000330657 GCGAATGGGTACAGAGAAGTA pLKO_005 1081 CDS 100% 4.950 6.930 N TTLL7 n/a
5 TRCN0000330658 CTAACAAGTCAGACCTTATTT pLKO_005 2441 CDS 100% 15.000 12.000 N TTLL7 n/a
6 TRCN0000353692 GGGAATTATAGACGAATTTAT pLKO_005 1757 CDS 100% 15.000 10.500 N TTLL7 n/a
7 TRCN0000134378 GTCCAATTTGACCCAGTTATA pLKO.1 1117 CDS 100% 13.200 9.240 N TTLL7 n/a
8 TRCN0000330588 TCTAGAATCTGCTAGGTTTAT pLKO_005 3342 3UTR 100% 13.200 9.240 N TTLL7 n/a
9 TRCN0000160330 CCTGAAGATAAAGCATTACTT pLKO.1 1781 CDS 100% 5.625 3.938 N TTLL7 n/a
10 TRCN0000160079 CAGGATCATTTGATTGTTCAA pLKO.1 947 CDS 100% 4.950 3.465 N TTLL7 n/a
11 TRCN0000160387 CCATCAAATGGTTTACAGAAT pLKO.1 1221 CDS 100% 4.950 3.465 N TTLL7 n/a
12 TRCN0000135092 CCTCTGAAGTTGAACATGCAA pLKO.1 3119 3UTR 100% 3.000 2.100 N TTLL7 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5479 3UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 3773 3UTR 100% 4.950 2.475 Y LILRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12610 pDONR223 100% 60.9% 59.3% None (many diffs) n/a
2 ccsbBroad304_12610 pLX_304 0% 60.9% 59.3% V5 (many diffs) n/a
3 TRCN0000466520 ATACGCACAAGGAAGCCATGCTGT pLX_317 22.5% 60.9% 59.3% V5 (many diffs) n/a
4 ccsbBroadEn_12611 pDONR223 100% 53.6% 53.5% None (many diffs) n/a
5 ccsbBroad304_12611 pLX_304 0% 53.6% 53.5% V5 (many diffs) n/a
6 TRCN0000471057 CCATAGTTATCAATTCGAACCTTA pLX_317 23.2% 53.6% 53.5% V5 (many diffs) n/a
Download CSV