Construct: ORF TRCN0000466611
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018404.1_s317c1
- Derived from:
- ccsbBroadEn_02286
- DNA Barcode:
- TATACTACTCCTGTTGCGCACCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACOT8 (10005)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466611
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10005 | ACOT8 | acyl-CoA thioesterase 8 | NM_005469.4 | 100% | 100% | |
2 | human | 10005 | ACOT8 | acyl-CoA thioesterase 8 | XM_005260239.3 | 83.3% | 73.5% | 0_1ins25;100_101ins134 |
3 | human | 10005 | ACOT8 | acyl-CoA thioesterase 8 | XR_244130.4 | 78.5% | 1_90del;736_786del;1099_1218del | |
4 | human | 10005 | ACOT8 | acyl-CoA thioesterase 8 | XR_001754105.1 | 67.5% | (many diffs) | |
5 | human | 10005 | ACOT8 | acyl-CoA thioesterase 8 | XM_011528480.2 | 57.6% | 57.6% | 0_1ins405 |
6 | mouse | 170789 | Acot8 | acyl-CoA thioesterase 8 | NM_133240.2 | 84.3% | 84.6% | (many diffs) |
7 | mouse | 170789 | Acot8 | acyl-CoA thioesterase 8 | XM_011239319.2 | 62.4% | 62.6% | (many diffs) |
8 | mouse | 170789 | Acot8 | acyl-CoA thioesterase 8 | XM_006498831.3 | 50.5% | 51% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1026
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcgtccccg caggccccag aagatgggca gggctgtggc gaccgcggcg 121 atccccctgg ggacctccgt agcgtcttgg tcacgaccgt gctcaacctc gagccgctgg 181 acgaggatct cttcagagga aggcattact gggtaccggc caagaggctg tttggtggtc 241 agatcgtggg ccaggccctg gtggctgcag ccaagtctgt gagtgaagac gtccacgtgc 301 actccctgca ctgctacttt gttcgggcag gggacccgaa gctgccagta ctgtaccaag 361 tggagcggac acgaacaggg tcgagcttct cggtgcgctc tgtgaaggcc gtgcaacatg 421 ggaagcccat cttcatctgc caggcctcct tccagcaggc ccagcccagc cccatgcagc 481 accagttctc catgcccact gtgccaccac cagaagagct gcttgactgt gagaccctca 541 ttgaccagta tttaagggac cctaacctcc aaaagaggta cccattggcg ctcaaccgaa 601 ttgctgctca ggaggtcccc attgagatca agccagtaaa cccatccccc cTGAGCCAGC 661 TGCAGAGAAT GGAGCCCAAA CAGATGTTCT GGGTGCGAGC CCGGGGCTAT ATTGGCGAGG 721 GCGACATGAA GATGCACTGC TGCGTGGCCG CCTATATCTC CGACTATGCC TTCTTGGGCA 781 CTGCACTGCT GCCTCACCAG TGGCAGCACA AGGTGCACTT CATGGTCTCA CTGGACCATT 841 CCATGTGGTT CCACGCCCCC TTCCGAGCTG ACCACTGGAT GCTCTATGAA TGCGAGAGCC 901 CCTGGGCCGG TGGCTCTCGG GGGCTGGTCC ATGGGCGGCT GTGGCGTCAG GATGGAGTCC 961 TAGCTGTGAC CTGTGCCCAG GAGGGCGTGA TCCGAGTGAA GCCCCAGGTC TCAGAGAGCA 1021 AGCTGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1081 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1141 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATATACTACT CCTGTTGCGC ACCTCACGCG 1201 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt