Transcript: Human XM_011528480.2

PREDICTED: Homo sapiens acyl-CoA thioesterase 8 (ACOT8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACOT8 (10005)
Length:
1195
CDS:
524..1078

Additional Resources:

NCBI RefSeq record:
XM_011528480.2
NBCI Gene record:
ACOT8 (10005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231844 GACCCTCATTGACCAGTATTT pLKO_005 583 CDS 100% 13.200 18.480 N ACOT8 n/a
2 TRCN0000231845 CATTGGCGCTCAACCGAATTG pLKO_005 633 CDS 100% 10.800 15.120 N ACOT8 n/a
3 TRCN0000231847 CCGCCTATATCTCCGACTATG pLKO_005 798 CDS 100% 10.800 15.120 N ACOT8 n/a
4 TRCN0000048870 GCCGCCTATATCTCCGACTAT pLKO.1 797 CDS 100% 4.950 6.930 N ACOT8 n/a
5 TRCN0000048868 CCAGTATTTAAGGGACCCTAA pLKO.1 595 CDS 100% 4.050 5.670 N ACOT8 n/a
6 TRCN0000249441 ACTCCCTGCACTGCTACTTTG pLKO_005 289 5UTR 100% 10.800 7.560 N Acot8 n/a
7 TRCN0000231846 ATTGAGATCAAGCCAGTAAAC pLKO_005 671 CDS 100% 10.800 7.560 N ACOT8 n/a
8 TRCN0000231848 CTGACCACTGGATGCTCTATG pLKO_005 918 CDS 100% 10.800 7.560 N ACOT8 n/a
9 TRCN0000048871 GAGACCCTCATTGACCAGTAT pLKO.1 581 CDS 100% 4.950 3.465 N ACOT8 n/a
10 TRCN0000048869 CCCATTGAGATCAAGCCAGTA pLKO.1 668 CDS 100% 4.050 2.835 N ACOT8 n/a
11 TRCN0000173695 CAAGTCTGTGAGTGAAGACGT pLKO.1 260 5UTR 100% 2.640 1.848 N Acot8 n/a
12 TRCN0000048872 CGCTCTGTGAAGGCCGTGCAA pLKO.1 446 5UTR 100% 0.000 0.000 N ACOT8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02286 pDONR223 100% 57.6% 57.6% None 0_1ins405 n/a
2 ccsbBroad304_02286 pLX_304 0% 57.6% 57.6% V5 0_1ins405 n/a
3 TRCN0000466611 TATACTACTCCTGTTGCGCACCTC pLX_317 39.2% 57.6% 57.6% V5 0_1ins405 n/a
Download CSV