Transcript: Mouse XM_006498831.3

PREDICTED: Mus musculus acyl-CoA thioesterase 8 (Acot8), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acot8 (170789)
Length:
884
CDS:
191..760

Additional Resources:

NCBI RefSeq record:
XM_006498831.3
NBCI Gene record:
Acot8 (170789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217544 CCCTCATTGACCAGTACTTAA pLKO.1 267 CDS 100% 13.200 18.480 N Acot8 n/a
2 TRCN0000257904 CCCTCATTGACCAGTACTTAA pLKO_005 267 CDS 100% 13.200 18.480 N Acot8 n/a
3 TRCN0000257893 CTAACCTTCACAAGAAGTATC pLKO_005 294 CDS 100% 10.800 8.640 N Acot8 n/a
4 TRCN0000257897 TTGCTGTGTGGCTGCTTATAT pLKO_005 469 CDS 100% 15.000 10.500 N Acot8 n/a
5 TRCN0000216897 GGTGTCAGAGAGTAAGCTATA pLKO.1 739 CDS 100% 10.800 7.560 N Acot8 n/a
6 TRCN0000257911 GGTGTCAGAGAGTAAGCTATA pLKO_005 739 CDS 100% 10.800 7.560 N Acot8 n/a
7 TRCN0000175957 GATCACTCCATGTGGTTTCAT pLKO.1 566 CDS 100% 5.625 3.938 N Acot8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02286 pDONR223 100% 50.5% 51% None (many diffs) n/a
2 ccsbBroad304_02286 pLX_304 0% 50.5% 51% V5 (many diffs) n/a
3 TRCN0000466611 TATACTACTCCTGTTGCGCACCTC pLX_317 39.2% 50.5% 51% V5 (many diffs) n/a
Download CSV