Transcript: Mouse XM_011239319.2

PREDICTED: Mus musculus acyl-CoA thioesterase 8 (Acot8), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acot8 (170789)
Length:
2613
CDS:
1785..2489

Additional Resources:

NCBI RefSeq record:
XM_011239319.2
NBCI Gene record:
Acot8 (170789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217544 CCCTCATTGACCAGTACTTAA pLKO.1 1996 CDS 100% 13.200 18.480 N Acot8 n/a
2 TRCN0000257904 CCCTCATTGACCAGTACTTAA pLKO_005 1996 CDS 100% 13.200 18.480 N Acot8 n/a
3 TRCN0000257893 CTAACCTTCACAAGAAGTATC pLKO_005 2023 CDS 100% 10.800 8.640 N Acot8 n/a
4 TRCN0000257897 TTGCTGTGTGGCTGCTTATAT pLKO_005 2198 CDS 100% 15.000 10.500 N Acot8 n/a
5 TRCN0000249441 ACTCCCTGCACTGCTACTTTG pLKO_005 108 5UTR 100% 10.800 7.560 N Acot8 n/a
6 TRCN0000216897 GGTGTCAGAGAGTAAGCTATA pLKO.1 2468 CDS 100% 10.800 7.560 N Acot8 n/a
7 TRCN0000257911 GGTGTCAGAGAGTAAGCTATA pLKO_005 2468 CDS 100% 10.800 7.560 N Acot8 n/a
8 TRCN0000175957 GATCACTCCATGTGGTTTCAT pLKO.1 2295 CDS 100% 5.625 3.938 N Acot8 n/a
9 TRCN0000173695 CAAGTCTGTGAGTGAAGACGT pLKO.1 79 5UTR 100% 2.640 1.584 N Acot8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02286 pDONR223 100% 62.4% 62.6% None (many diffs) n/a
2 ccsbBroad304_02286 pLX_304 0% 62.4% 62.6% V5 (many diffs) n/a
3 TRCN0000466611 TATACTACTCCTGTTGCGCACCTC pLX_317 39.2% 62.4% 62.6% V5 (many diffs) n/a
Download CSV