Construct: ORF TRCN0000466678
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008808.1_s317c1
- Derived from:
- ccsbBroadEn_12171
- DNA Barcode:
- TAGTCAGCGTCGCATTGCGCGTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RFWD3 (55159)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466678
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370534.1 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
2 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370535.1 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
3 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_018124.4 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
4 | human | 55159 | RFWD3 | ring finger and WD repeat d... | XM_005256022.4 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
5 | human | 55159 | RFWD3 | ring finger and WD repeat d... | XM_011523191.3 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
6 | human | 55159 | RFWD3 | ring finger and WD repeat d... | XM_017023391.1 | 96.6% | 96.5% | 1_75del;1175G>A;2309T>C |
7 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370536.1 | 89% | 88.8% | (many diffs) |
8 | human | 55159 | RFWD3 | ring finger and WD repeat d... | XM_006721228.3 | 89% | 88.8% | (many diffs) |
9 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370537.1 | 66.1% | 65.9% | 0_1ins759;341G>A;1475T>C |
10 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370539.1 | 66.1% | 65.9% | 0_1ins759;341G>A;1475T>C |
11 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370540.1 | 66.1% | 65.9% | 0_1ins759;341G>A;1475T>C |
12 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370542.1 | 66.1% | 65.9% | 0_1ins759;341G>A;1475T>C |
13 | human | 55159 | RFWD3 | ring finger and WD repeat d... | NM_001370543.1 | 66.1% | 65.9% | 0_1ins759;341G>A;1475T>C |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2313
- ORF length:
- 2247
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cagcagccaa gggggaccag ccctcctcca gcctgttcct gctgatgtgg 121 tcagcagcca gggggtacca tccatcctcc agccagctcc tgctgaggtg atcagcagcc 181 aagcgacacc acccctgctc cagcctgctc cgcaactgtc tgttgacctg acagaagtgg 241 aggtcttggg agaagacact gtggagaaca tcaatccaag aacttcagaa caacataggc 301 agggatctga tggtaatcac accatcccag catcttcgtt gcattcaatg accaacttca 361 tcagcggact gcagagactt catggcatgc tggaattcct gagaccttca tcttcaaacc 421 acagtgtagg gccaatgaga acaagaagga gggtatctgc ttcacggagg gcaagagccg 481 gagggtctca gaggacagac agtgccaggt tgagagcacc attggatgct tactttcagg 541 tgagcaggac ccagcctgac ttgccagcta ccacttatga ttcagagact aggaatcctg 601 tatctgaaga gttgcaggtg tctagtagtt ctgattctga cagtgacagc tctgcagagt 661 atggaggggt tgttgaccag gcagaggaat ctggagctgt cattttagaa gagcaactag 721 caggtgtctc agcagagcaa gaagttacat gtatcgatgg aggcaagacc ctccccaaac 781 agccatctcc ccagaagtct gagcctctgc taccttctgc ttctatggat gaggaagaag 841 gggacacttg tacaatatgt ctggaacagt ggaccaatgc tggggaccac cggctctcag 901 cattacgctg tgggcatctc tttgggtata ggtgcatttc cacgtggctt aaaggacaag 961 tacgaaaatg tccccagtgc aacaagaaag ccaggcacag tgacattgtc gtcctttatg 1021 cccgaaccct gagagctttg gacactagtg aacaggagcg catgaaaagt tccctactga 1081 aggaacagat gctaaggaaa caggccgagt tagaatcagc acagtgccga ctccaactgc 1141 aggtcctcac tgataagtgc actaagcttc aaaggcgtgt tcaggacttg caaaaactta 1201 cgtcacatca aagtcagaat ttacagcaac ccaggggctc ccaagcatgg gtcctgagct 1261 gctcaccctc cagccagggc cagcacaagc acaagtacca cttccaaaag accttcacag 1321 tatctcaggc aggaaactgc cggatcatgg catactgtga tgctctgagc tgcctggtga 1381 tatcacagcc ttctcctcag gcctcttttc ttccaggctt tggtgttaag atgttgagta 1441 ctgccaacat gaagagcagt cagtacattc cgatgcatgg caaacagatc cgtggactgg 1501 cgtttagcag ttacctcaga ggcttgctac tctctgcttc cctagacaac actattaaac 1561 tgaccagcct ggagacaaat accgtggtcc agacttataa tgctggacgt cctgtctgga 1621 gctgttgctg gtgtcttgat gaggctaact acatctatgc tggactggcc aatggttcaa 1681 ttctggtata tgacgtgcga aacacgagca gtcatgtgca ggagttagta gctcagaaag 1741 ccagatgccc actggtctcc ctgtcataca tgcccagagc tgcctcagct gcatttccat 1801 atggtggggt gctggctgga accttggagg atgcttcatt ctgggaacag aaaatggact 1861 tttctcattg gcctcatgtg ctgcccttgg agccaggggg ctgcatagac tttcagacag 1921 agaacagctc ccggcactgt cttgtgaccT ACAGGCCTGA TAAAAATCAC ACCACCATAC 1981 GAAGTGTGCT GATGGAAATG TCCTACCGAC TGGATGACAC TGGAAATCCA ATCTGCTCCT 2041 GCCAGCCTGT ACATACATTT TTTGGAGGAC CTACTTGCAA ACTATTGACC AAAAATGCCA 2101 TTTTCCAAAG CCCAGAGAAT GATGGCAACA TCCTGGTGTG TACTGGGGAT GAAGCAGCAA 2161 ATTCTGCCCT GCTGTGGGAT GCTGCCAGTG GCTCGTTGCT CCAGGACCTA CAGACCGATC 2221 AGCCTGTGTT GGACATCTGC CCATTTGAGG TGAACCGTAA CAGCTACTTG GCTACCTTAA 2281 CAGAGAAGAT GGTCCACACC TATAAGTGGG AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 2341 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2401 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATA 2461 GTCAGCGTCG CATTGCGCGT CTACGCGTTA AGTCgacaat caacctctgg attacaaaat 2521 ttgtgaaaga tt