Transcript: Human NM_001370540.1

Homo sapiens ring finger and WD repeat domain 3 (RFWD3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RFWD3 (55159)
Length:
4598
CDS:
579..2069

Additional Resources:

NCBI RefSeq record:
NM_001370540.1
NBCI Gene record:
RFWD3 (55159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435264 GAGTAATTGATGGGTACTTTA pLKO_005 2264 3UTR 100% 13.200 18.480 N RFWD3 n/a
2 TRCN0000434743 AGATCCGTGGACTGGCGTTTA pLKO_005 1240 CDS 100% 10.800 8.640 N RFWD3 n/a
3 TRCN0000033867 GTGTTGGACATCTGCCCATTT pLKO.1 1980 CDS 100% 10.800 8.640 N RFWD3 n/a
4 TRCN0000430738 ACCGTGGTCCAGACTTATAAT pLKO_005 1335 CDS 100% 15.000 10.500 N RFWD3 n/a
5 TRCN0000425612 CCATCGTCTTGGTACTGATTT pLKO_005 2494 3UTR 100% 13.200 9.240 N RFWD3 n/a
6 TRCN0000033864 GCTTCCCTAGACAACACTATT pLKO.1 1290 CDS 100% 13.200 9.240 N RFWD3 n/a
7 TRCN0000033866 CAATGGTTCAATTCTGGTATA pLKO.1 1424 CDS 100% 10.800 7.560 N RFWD3 n/a
8 TRCN0000033868 CCCAGAGAATGATGGCAACAT pLKO.1 1865 CDS 100% 4.950 3.465 N RFWD3 n/a
9 TRCN0000033865 CGTCACATCAAAGTCAGAATT pLKO.1 955 CDS 100% 0.000 0.000 N RFWD3 n/a
10 TRCN0000419496 CAGTGACATTGTCGTCCTTTA pLKO_005 752 CDS 100% 10.800 6.480 N RFWD3 n/a
11 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4088 3UTR 100% 13.200 6.600 Y IQCC n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4188 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12171 pDONR223 100% 66.1% 65.9% None 0_1ins759;341G>A;1475T>C n/a
2 ccsbBroad304_12171 pLX_304 0% 66.1% 65.9% V5 0_1ins759;341G>A;1475T>C n/a
3 TRCN0000466678 TAGTCAGCGTCGCATTGCGCGTCT pLX_317 16.4% 66.1% 65.9% V5 0_1ins759;341G>A;1475T>C n/a
Download CSV