Construct: ORF TRCN0000466722
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007864.1_s317c1
- Derived from:
- ccsbBroadEn_02463
- DNA Barcode:
- CAGCCCGCCGCGTTCTTTCCGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TM9SF1 (10548)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466722
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10548 | TM9SF1 | transmembrane 9 superfamily... | NM_006405.7 | 100% | 100% | |
| 2 | human | 10548 | TM9SF1 | transmembrane 9 superfamily... | NM_001289006.1 | 85.6% | 85.6% | 0_1ins261 |
| 3 | human | 10548 | TM9SF1 | transmembrane 9 superfamily... | NM_001014842.3 | 79.8% | 76.8% | (many diffs) |
| 4 | mouse | 74140 | Tm9sf1 | transmembrane 9 superfamily... | NM_028780.3 | 92.9% | 97.5% | (many diffs) |
| 5 | mouse | 74140 | Tm9sf1 | transmembrane 9 superfamily... | XM_017316217.1 | 92.9% | 97.5% | (many diffs) |
| 6 | mouse | 74140 | Tm9sf1 | transmembrane 9 superfamily... | XM_006519616.1 | 77.1% | 66.5% | (many diffs) |
| 7 | mouse | 74140 | Tm9sf1 | transmembrane 9 superfamily... | XM_011245209.1 | 67.2% | 64.7% | (many diffs) |
| 8 | mouse | 74140 | Tm9sf1 | transmembrane 9 superfamily... | XM_006519617.2 | 63.8% | 60.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1884
- ORF length:
- 1818
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac agtcgtaggg aaccctcgaa gttggagctg ccagtggttg ccaatcctga 121 tactgttgct gggcacaggc catgggccag gggtggaagg cgtgacacac tacaaggccg 181 gcgaccctgt tattctgtat gtcaacaaag tgggacccta ccataaccct caggaaactt 241 accactacta tcagcttcca gtctgctgcc ctgagaagat acgtcacaaa agccttagcc 301 tgggtgaagt gctggatggg gaccgaatgg ctgagtcttt gtatgagatc cgctttcggg 361 aaaacgtgga gaagagaatt ctgtgccaca tgcagctcag ttctgcacag gtggagcagc 421 tgcgccaggc cattgaagaa ctgtactact ttgaatttgt ggtagatgac ttgccaatcc 481 ggggctttgt gggctacatg gaggagagtg gtttcctgcc acacagccac aagataggac 541 tctggaccca tttggacttc cacctagaat tccatggaga ccgaattata tttgccaatg 601 tttcagtgcg ggacgtcaag ccccacagct tggatgggtt acgacctgac gagttcctag 661 gccttaccca cacttatagc gtgcgctggt ctgagacttc agtggagcgt cggagtgaca 721 ggcgccgtgg tgacgatggt ggtttctttc ctcgaacact ggaaatccat tggttgtcca 781 tcatcaactc catggtgctt gtgtttttac tggtgggttt tgtggctgtc attctaatgc 841 gtgtgcttcg gaatgacctg gctcggtaca acttagatga ggagaccacc tctgcaggtt 901 ctggtgatga ctttgaccag ggtgacaatg gctggaaaat tatccataca gatgtcttcc 961 gcttcccccc ataccgtggt ctgctctgtg ctgtgcttgg cgtgggtgcc cagttcctgg 1021 cccttggcac tggcattatt gtcatggcac tgctgggcat gttcaatgtg caccgtcatg 1081 gggccattaa ctcagcagcc atcttgttgt atgccctgac ctgctgcatc tctggctacg 1141 tgtccagcca cttctaccgg cagattggag gcgagcgttg ggtgtggaac atcattctca 1201 ccaccagtct cttctctgtg cctttcttcc tgacgtggag tgtggtgaac tcagtgcatt 1261 gggccaatgg ttcgacacag gctctgccag ccacaaccat cctgctgctt ctgacggttt 1321 ggctgctggt gggctttccc ctcactgtca ttggaggcat ctttgggaag aacaacgcca 1381 gcccctttga tgcaccctgt cgcaccaaga acatcgcccg ggagattcca ccccagccct 1441 ggtacaagtc tactgtcatc cacatgactg ttggaggctt cctgcctttc agtgccatct 1501 ctgtggagct gtactacatc tttgccacag tatggggtcg ggagcagtac actttgtacg 1561 gcatcctctt ctttgtcttc gccatcctgc tgagtgtggg ggcttgcatc tccattgcac 1621 tcacctactt ccagttgtct ggggaggatt accgctggtg gtggcgatct gtgctgagtg 1681 ttggctCCAC CGGCCTCTTC ATCTTCCTCT ACTCAGTTTT CTATTATGCC CGGCGCTCCA 1741 ACATGTCTGG GGCAGTACAG ACAGTAGAGT TCTTCGGCTA CTCCTTACTC ACTGGTTATG 1801 TCTTCTTCCT CATGCTGGGC ACCATCTCCT TTTTTTCTTC CCTAAAGTTC ATCCGGTATA 1861 TCTATGTTAA CCTCAAGATG GACTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1921 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1981 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC AGCCCGCCGC 2041 GTTCTTTCCG TTTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 2101 att