Transcript: Human NM_001014842.3

Homo sapiens transmembrane 9 superfamily member 1 (TM9SF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TM9SF1 (10548)
Length:
1882
CDS:
114..1583

Additional Resources:

NCBI RefSeq record:
NM_001014842.3
NBCI Gene record:
TM9SF1 (10548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059665 CCTACCATAACCCTCAGGAAA pLKO.1 265 CDS 100% 4.950 3.960 N TM9SF1 n/a
2 TRCN0000126831 CCATTGGTTGTCCATCATCAA pLKO.1 815 CDS 100% 4.950 3.465 N Tm9sf1 n/a
3 TRCN0000059663 CCTGAGAAGATACGTCACAAA pLKO.1 318 CDS 100% 4.950 3.465 N TM9SF1 n/a
4 TRCN0000301128 CCTGAGAAGATACGTCACAAA pLKO_005 318 CDS 100% 4.950 3.465 N TM9SF1 n/a
5 TRCN0000126830 CCCTCAGGAAACTTACCACTA pLKO.1 275 CDS 100% 4.050 2.835 N Tm9sf1 n/a
6 TRCN0000059666 CCTCGAACACTGGAAATCCAT pLKO.1 798 CDS 100% 3.000 2.100 N TM9SF1 n/a
7 TRCN0000301048 CCTCGAACACTGGAAATCCAT pLKO_005 798 CDS 100% 3.000 2.100 N TM9SF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02463 pDONR223 100% 79.8% 76.8% None (many diffs) n/a
2 ccsbBroad304_02463 pLX_304 0% 79.8% 76.8% V5 (many diffs) n/a
3 TRCN0000466722 CAGCCCGCCGCGTTCTTTCCGTTT pLX_317 11.3% 79.8% 76.8% V5 (many diffs) n/a
Download CSV