Construct: ORF TRCN0000466740
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006762.1_s317c1
- Derived from:
- ccsbBroadEn_08056
- DNA Barcode:
- CTTCTGTCGCCTGGTTCGTCCCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SDCBP2 (27111)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466740
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27111 | SDCBP2 | syndecan binding protein 2 | NM_001199784.1 | 99.8% | 100% | 705G>A |
2 | human | 27111 | SDCBP2 | syndecan binding protein 2 | NM_080489.5 | 99.8% | 100% | 705G>A |
3 | human | 27111 | SDCBP2 | syndecan binding protein 2 | NM_015685.5 | 70.7% | 70.8% | 0_1ins255;450G>A |
4 | human | 100528031 | FKBP1A-SDCBP2 | FKBP1A-SDCBP2 readthrough (... | NR_037661.1 | 51.8% | 1_278del;983G>A;1155_1689del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc atccctgtac ccatctctag aggacctaaa agtggaccaa gccattcagg 121 cccaggtcag agcctcaccc aagatgccag ccctgccagt ccaggcaaca gccatttccc 181 caccaccagt tttgtaccca aacttggcag aactggaaaa ttatatgggt ctttccctct 241 ccagccaaga agtccaggag agcctgcttc agattccaga gggtgacagt acagcggtct 301 cgggccccgg gcccggccag atggtggcac cggtaaccgg gtacagcctg ggcgtgcggc 361 gagctgagat caagcccggg gtgcgcgaga tccacctgtg caaggacgag cgcggcaaga 421 ccgggctgag gctgcggaag gtcgaccagg ggctctttgt gcagttggtc caggccaaca 481 cccctgcatc ccttgtgggg ctgcgctttg gggaccagct cctgcagatt gacgggcgtg 541 actgtgctgg gtggagctcg cacaaagccc atcaggtggt gaagaaggca tcaggcgata 601 agattgtcgt ggtggttcgg gacaggccgt tccagcggac tgtcaccatg cacaaggaca 661 gcatgggcca cgtcggcttc gtgatcaaga agggGAAGAT TGTCTCTCTG GTCAAAGGGA 721 GTTCTGCGGC CCGCAACGGG CTCCTCACCA ACCACTACGT GTGTGAGGTA GACGGGCAGA 781 ATGTTATCGG GCTGAAGGAC AAAAAGATCA TGGAGATTCT GGCCACGGCT GGGAACGTTG 841 TCACCCTGAC CATCATCCCC AGTGTGATCT ACGAGCACAT GGTCAAAAAG TTGCCTCCAG 901 TCCTGCTCCA CCACACCATG GACCACTCCA TCCCAGATGC CTGCCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGACTT CTGTCGCCTG GTTCGTCCCG TACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t