Transcript: Human NM_080489.5

Homo sapiens syndecan binding protein 2 (SDCBP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SDCBP2 (27111)
Length:
1485
CDS:
75..953

Additional Resources:

NCBI RefSeq record:
NM_080489.5
NBCI Gene record:
SDCBP2 (27111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080489.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415562 GATTCTCTTGTGCTGATTTAA pLKO_005 1178 3UTR 100% 15.000 7.500 Y SDCBP2 n/a
2 TRCN0000433023 GTGACCATGGGATGGCTTATA pLKO_005 1089 3UTR 100% 13.200 6.600 Y SDCBP2 n/a
3 TRCN0000063841 GAAGAAGGCATCAGGCGATAA pLKO.1 590 CDS 100% 10.800 5.400 Y SDCBP2 n/a
4 TRCN0000063840 GAAGATTGTCTCTCTGGTCAA pLKO.1 704 CDS 100% 4.050 2.025 Y SDCBP2 n/a
5 TRCN0000063838 GCAGAATGTTATCGGGCTGAA pLKO.1 785 CDS 100% 4.050 2.025 Y SDCBP2 n/a
6 TRCN0000063839 GATAAGATTGTCGTGGTGGTT pLKO.1 606 CDS 100% 2.640 1.320 Y SDCBP2 n/a
7 TRCN0000063842 GCGGACTGTCACCATGCACAA pLKO.1 644 CDS 100% 1.350 0.675 Y SDCBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080489.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08056 pDONR223 100% 99.8% 100% None 705G>A n/a
2 ccsbBroad304_08056 pLX_304 0% 99.8% 100% V5 705G>A n/a
3 TRCN0000466740 CTTCTGTCGCCTGGTTCGTCCCGT pLX_317 28.7% 99.8% 100% V5 705G>A n/a
Download CSV