Construct: ORF TRCN0000466880
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003484.1_s317c1
- Derived from:
- ccsbBroadEn_11466
- DNA Barcode:
- CTTTTGTGTCCATAAGCAAACTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TNK2 (10188)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466880
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | NM_005781.4 | 48.7% | 47.4% | (many diffs) |
2 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | NM_001308046.1 | 48.6% | 47.3% | (many diffs) |
3 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | NM_001010938.2 | 48.5% | 47.3% | (many diffs) |
4 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_005269270.3 | 48.1% | 46.9% | (many diffs) |
5 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_011512320.1 | 48.1% | 46.9% | (many diffs) |
6 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_017005510.1 | 48.1% | 46.9% | (many diffs) |
7 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_024453293.1 | 48.1% | 46.9% | (many diffs) |
8 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_024453294.1 | 48.1% | 46.9% | (many diffs) |
9 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_024453295.1 | 48.1% | 46.9% | (many diffs) |
10 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_024453292.1 | 47.4% | 46.2% | (many diffs) |
11 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_017005509.1 | 47.3% | 46% | (many diffs) |
12 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_017005508.1 | 47.1% | 45.9% | (many diffs) |
13 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_011512318.2 | 46.8% | 45.6% | (many diffs) |
14 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_005269268.3 | 45.5% | 44.3% | (many diffs) |
15 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_024453291.1 | 45.4% | 44.3% | (many diffs) |
16 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_011512317.3 | 41.7% | 40.6% | (many diffs) |
17 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_011512321.2 | 41% | 39.6% | (many diffs) |
18 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_005269274.3 | 25.7% | 24.4% | (many diffs) |
19 | human | 10188 | TNK2 | tyrosine kinase non receptor 2 | XM_005269275.3 | 18.7% | 17.3% | (many diffs) |
20 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | NM_001110147.1 | 45% | 47.9% | (many diffs) |
21 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522340.3 | 43.7% | 46.4% | (many diffs) |
22 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_017317066.1 | 43.6% | 46.4% | (many diffs) |
23 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522339.1 | 43.6% | 45.9% | (many diffs) |
24 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | NM_016788.3 | 43.2% | 45.5% | (many diffs) |
25 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522338.3 | 43.2% | 45.5% | (many diffs) |
26 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522337.3 | 42.5% | 45.1% | (many diffs) |
27 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_017317065.1 | 42.4% | 45.1% | (many diffs) |
28 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522336.3 | 42.4% | 45% | (many diffs) |
29 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522335.1 | 42.3% | 44.5% | (many diffs) |
30 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522334.3 | 42% | 44.3% | (many diffs) |
31 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522333.3 | 42% | 44.2% | (many diffs) |
32 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_006522332.3 | 42% | 44.2% | (many diffs) |
33 | mouse | 51789 | Tnk2 | tyrosine kinase, non-recept... | XM_011245946.1 | 29.1% | 30.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1650
- ORF length:
- 1584
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gccagaggag ggcacaggct ggctgctgga gctgctgtcc gaggtgcagc 121 tgcaacagta cttcctgcgg ctccgagacg acctcaacgt cacccgcctg tcccactttg 181 agtacgtcaa gaatgaggac ctggagaaga tcggcatggg tcggcctggc cagcggcggc 241 tgtgggaggc tgtgaagagg aggaaggcct tgtgcaaacg caagtcgtgg atgagtaagg 301 tgttcagtgg aaagcgactg gaggctgagt tcccacctca tcactctcag agcaccttcc 361 ggaagacctc gcccgcccct gggggcccag caggggaggg gcccctgcag agcctcacct 421 gcctcattgg ggagaaggac ctgcgcctcc tggagaagct gggtgatggt tcctttggcg 481 tggtgcgcag gggcgagtgg gacgcgccct cagggaagac ggtgagtgtg gctgtgaagt 541 gcctgaagcc cgatgtcctg agccagccag aagccatgga cgacttcatc cgggaggtca 601 atgccatgca ctcgctcgac caccgaaacc tcatccgcct ctacggggtg gtgctcacgc 661 cgcccatgaa gatggtgaca gagctggcac ctctgggatc gttgttggac cggctacgta 721 agcaccaggg ccacttcctc ctggggactc tgagccgcta cgctgtgcag gtggctgagg 781 gcatgggcta cctggagtcc aagcgcttta ttcaccgtga cctggctgcc cgcaatctgc 841 tgttggctac ccgcgacctg gtcaagatcg gggactttgg gctgatgcga gcactacctc 901 agaatgacga ccattacgtc atgcaggaac atcgcaaggt gcccttcgcc tggtgtgccc 961 ccgagagcct gaagacacgt accttctccc atgccagcga cacctggatg ttcggggtga 1021 cactgtggga aatgttcacc tacggccagg agccctggat cggcctcaac ggcagtcaga 1081 tcctgcataa gatcgacaag gagggggagc ggctgccccg gcccgaggac tgtccccagg 1141 acatctacaa cgtcatggtc cagtgctggg ctcacaagcc agaggacaga cccacgtttg 1201 tggccctgcg ggacttcctg ctggaggccc agcccacaga catgcgggcc cttcaggact 1261 tTGAGGAACC GGACAAGCTG CACATCCAGA TGAATGATGT CATCACCGTC ATCGAGGGAA 1321 GGGCCGAGAA CTACTGGTGG CGTGGCCAGA ACACACGGAC GCTGTGTGTG GGGCCCTTCC 1381 CTCGCAACGT GGTGACCTCC GTGGCCGGCC TGTCGGCCCA GGACATCAGC CAGCCCCTGC 1441 AGAACAGCTT CATCCACACA GGGCATGGCG ACAGTGACCC CCGCCACTGC TGGGGCTTCC 1501 CGGACAGGAT TGACGAGTGT CCTTTCTCTG CCTTCTCTCC AGGACACCCC CCAGCTGAGA 1561 CGTGCGGTCA GGTTCTGTGG ACTGGGAGGC GGGAGGCCTG TGCTTCAGAC CCAAGACTAC 1621 ACCCGGTTTC CTCCAGGACG AAGGGGCTCT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1681 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1741 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACTTTT 1801 GTGTCCATAA GCAAACTTAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1861 tgaaagatt