Transcript: Human NM_001308046.1

Homo sapiens tyrosine kinase non receptor 2 (TNK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TNK2 (10188)
Length:
4243
CDS:
297..3419

Additional Resources:

NCBI RefSeq record:
NM_001308046.1
NBCI Gene record:
TNK2 (10188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195647 CCCACTTTGAGTACGTCAAGA pLKO.1 499 CDS 100% 4.950 6.930 N TNK2 n/a
2 TRCN0000002038 GTCGTGGATGAGTAAGGTGTT pLKO.1 611 CDS 100% 4.050 5.670 N TNK2 n/a
3 TRCN0000002040 TGACGAACTGTATCTGGGAAA pLKO.1 1838 CDS 100% 4.050 5.670 N TNK2 n/a
4 TRCN0000197093 GCCTTACCATGGACTTGAATG pLKO.1 3932 3UTR 100% 10.800 7.560 N TNK2 n/a
5 TRCN0000195521 CATTACGTCATGCAGGAACAT pLKO.1 1239 CDS 100% 4.950 3.465 N TNK2 n/a
6 TRCN0000199131 CCAGACCAACTACGCCTTTGT pLKO.1 2390 CDS 100% 4.950 3.465 N TNK2 n/a
7 TRCN0000002041 CTGCATAAGATCGACAAGGAG pLKO.1 1410 CDS 100% 2.640 1.848 N TNK2 n/a
8 TRCN0000199020 CCGGACAGGATTGACGAACTG pLKO.1 1827 CDS 100% 1.350 0.945 N TNK2 n/a
9 TRCN0000195330 CCAGATGAATGATGTCATCAC pLKO.1 1613 CDS 100% 0.405 0.284 N TNK2 n/a
10 TRCN0000199936 GCGCTGTCCCTGCACACTTTG pLKO.1 3603 3UTR 100% 0.000 0.000 N TNK2 n/a
11 TRCN0000002039 TGCTTCCTCTTCCACCCAATT pLKO.1 4108 3UTR 100% 10.800 6.480 N TNK2 n/a
12 TRCN0000002042 CAACTTCTCCACCAACAACAG pLKO.1 3155 CDS 100% 4.050 2.430 N TNK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488774 ATCGAATTATCCTTTTGCTGGTCT pLX_317 11.4% 94.2% 94.2% V5 (not translated due to prior stop codon) 1_96del;2987_2988ins90 n/a
2 ccsbBroadEn_11466 pDONR223 100% 48.6% 47.3% None (many diffs) n/a
3 ccsbBroad304_11466 pLX_304 0% 48.6% 47.3% V5 (many diffs) n/a
4 TRCN0000466880 CTTTTGTGTCCATAAGCAAACTTA pLX_317 24.8% 48.6% 47.3% V5 (many diffs) n/a
Download CSV