Construct: ORF TRCN0000466911
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013246.1_s317c1
- Derived from:
- ccsbBroadEn_06904
- DNA Barcode:
- TCTCCCGACCTTGTTACGGACCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RXRB (6257)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466911
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6257 | RXRB | retinoid X receptor beta | NM_021976.5 | 99.9% | 100% | 1152C>T |
| 2 | human | 6257 | RXRB | retinoid X receptor beta | NM_001270401.2 | 99.1% | 99.2% | 1152C>T;1256_1267del |
| 3 | human | 6257 | RXRB | retinoid X receptor beta | XM_005249278.3 | 81.3% | 71.8% | (many diffs) |
| 4 | human | 6257 | RXRB | retinoid X receptor beta | XM_011514796.3 | 77.4% | 77.4% | 234_235ins351;801C>T;905_916del |
| 5 | human | 6257 | RXRB | retinoid X receptor beta | XM_017011176.1 | 76.2% | 76.3% | 0_1ins369;783C>T;887_898del |
| 6 | human | 6257 | RXRB | retinoid X receptor beta | NM_001291989.1 | 63.6% | 63.3% | (many diffs) |
| 7 | mouse | 20182 | Rxrb | retinoid X receptor beta | NM_011306.4 | 89.4% | 94.7% | (many diffs) |
| 8 | mouse | 20182 | Rxrb | retinoid X receptor beta | NM_001205214.1 | 88.7% | 94% | (many diffs) |
| 9 | mouse | 20182 | Rxrb | retinoid X receptor beta | NM_001205216.1 | 70.7% | 75.9% | (many diffs) |
| 10 | mouse | 20182 | Rxrb | retinoid X receptor beta | NM_001205215.1 | 70.2% | 75.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1665
- ORF length:
- 1599
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ttgggccgct cgcccgccct tcctccctca gcggcatgcc gcagggcagt 121 gtgggccggt gggggtgcga aaagaaatgc attgtggggt cgcgtcccgg tggcggcggc 181 gacggccctg gctggatccc gcagcggcgg cggcggcggc ggtggcaggc ggagaacaac 241 aaaccccgga gccggagcca ggggaggctg gacgggacgg gatgggcgac agcgggcggg 301 actcccgaag cccagacagc tcctccccaa atccccttcc ccagggagtc cctccccctt 361 ctcctcctgg gccaccccta cccccttcaa cagctccatc ccttggaggc tctggggccc 421 cacccccacc cccgatgcca ccacccccac tgggctctcc ctttccagtc atcagttctt 481 ccatggggtc ccctggtctg ccccctccag ctcccccagg attctccggg cctgtcagca 541 gcccccagat taactcaaca gtgtcactcc ctgggggtgg gtctggcccc cctgaagatg 601 tgaagccacc agtcttaggg gtccggggcc tgcactgtcc accccctcca ggtggccctg 661 gggctggcaa acggctatgt gcaatctgcg gggacagaag ctcaggcaaa cactacgggg 721 tttacagctg tgagggttgc aagggcttct tcaaacgcac catccgcaaa gaccttacat 781 actcttgccg ggacaacaaa gactgcacag tggacaagcg ccagcggaac cgctgtcagt 841 actgccgcta tcagaagtgc ctggccactg gcatgaagag ggaggcggta caggaggagc 901 gtcagcgggg aaaggacaag gatggggatg gggagggggc tgggggagcc cccgaggaga 961 tgcctgtgga caggatcctg gaggcagagc ttgctgtgga acagaagagt gaccagggcg 1021 ttgagggtcc tgggggaacc gggggtagcg gcagcagccc aaatgaccct gtgactaaca 1081 tctgtcaggc agctgacaaa cagctattca cgcttgttga gtgggcgaag aggatcccac 1141 acttttcctc cttgcctctg gatgatcagg tcatattgct gcgggcaggc tggaatgaac 1201 tcctcattgc ctccttttca caccgatcca ttgatgttcg agatggcatc ctccttgcca 1261 caggtcttca cgtgcaccgc aactcagccc attcagcagg agtaggagcc atctttgatc 1321 gggtgctgac agagctagtg tccaaaatgc gtgacatgag gatggacaag acagagcttg 1381 gctgcctgag ggcaaTCATT CTGTTTAATC CAGATGCCAA GGGCCTCTCC AACCCTAGTG 1441 AGGTGGAGGT CCTGCGGGAG AAAGTGTATG CATCACTGGA GACCTACTGC AAACAGAAGT 1501 ACCCTGAGCA GCAGGGACGG TTTGCCAAGC TGCTGCTACG TCTTCCTGCC CTCCGGTCCA 1561 TTGGCCTTAA GTGTCTAGAG CATCTGTTTT TCTTCAAGCT CATTGGTGAC ACCCCCATCG 1621 ACACCTTCCT CATGGAGATG CTTGAGGCTC CCCATCAACT GGCCTGCCCA ACTTTCTTGT 1681 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1741 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1801 GAAAGGACGA TCTCCCGACC TTGTTACGGA CCAAACGCGT TAAGTCgaca atcaacctct 1861 ggattacaaa atttgtgaaa gatt