Transcript: Human NM_001291989.1

Homo sapiens retinoid X receptor beta (RXRB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RXRB (6257)
Length:
2212
CDS:
72..1115

Additional Resources:

NCBI RefSeq record:
NM_001291989.1
NBCI Gene record:
RXRB (6257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021625 CCATCCGCAAAGACCTTACAT pLKO.1 196 CDS 100% 5.625 7.875 N RXRB n/a
2 TRCN0000021627 GCAAAGACCTTACATACTCTT pLKO.1 202 CDS 100% 4.950 6.930 N RXRB n/a
3 TRCN0000021624 CGATCCATTGATGTTCGAGAT pLKO.1 660 CDS 100% 4.050 5.670 N RXRB n/a
4 TRCN0000021626 GAGGGCAATCATTCTGTTTAA pLKO.1 836 CDS 100% 13.200 10.560 N RXRB n/a
5 TRCN0000232842 AGGGCAATCATTCTGTTTAAT pLKO_005 837 CDS 100% 15.000 10.500 N RXRB n/a
6 TRCN0000232841 CTGGATGATCAGGTCATATTG pLKO_005 594 CDS 100% 13.200 9.240 N RXRB n/a
7 TRCN0000232843 TGTCGGGTTCTCCCATGATTT pLKO_005 1352 3UTR 100% 13.200 9.240 N RXRB n/a
8 TRCN0000232840 ATCCGCAAAGACCTTACATAC pLKO_005 198 CDS 100% 10.800 7.560 N RXRB n/a
9 TRCN0000021628 GCGTGACATGAGGATGGACAA pLKO.1 797 CDS 100% 4.050 2.835 N RXRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06904 pDONR223 99.5% 63.6% 63.3% None (many diffs) n/a
2 ccsbBroad304_06904 pLX_304 0% 63.6% 63.3% V5 (many diffs) n/a
3 TRCN0000466911 TCTCCCGACCTTGTTACGGACCAA pLX_317 17.2% 63.6% 63.3% V5 (many diffs) n/a
Download CSV