Transcript: Mouse NM_001205216.1

Mus musculus retinoid X receptor beta (Rxrb), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rxrb (20182)
Length:
2344
CDS:
240..1472

Additional Resources:

NCBI RefSeq record:
NM_001205216.1
NBCI Gene record:
Rxrb (20182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339804 ATGTGAAGCCACCGGTCTTAG pLKO_005 403 CDS 100% 10.800 8.640 N Rxrb n/a
2 TRCN0000222386 CGGGCAATCATACTGTTTAAT pLKO.1 1194 CDS 100% 15.000 10.500 N Rxrb n/a
3 TRCN0000339803 CGGGCAATCATACTGTTTAAT pLKO_005 1194 CDS 100% 15.000 10.500 N Rxrb n/a
4 TRCN0000339805 AGATCCCTGTGAGGACTATAT pLKO_005 1630 3UTR 100% 13.200 9.240 N Rxrb n/a
5 TRCN0000222387 CCTTCCCAGTCATCAGTTCTT pLKO.1 265 CDS 100% 4.950 3.465 N Rxrb n/a
6 TRCN0000339868 CCTTCCCAGTCATCAGTTCTT pLKO_005 265 CDS 100% 4.950 3.465 N Rxrb n/a
7 TRCN0000222390 GCCCAAATGACCCAGTGACTA pLKO.1 862 CDS 100% 4.950 3.465 N Rxrb n/a
8 TRCN0000222388 GTCGTGATAACAAAGACTGTA pLKO.1 592 CDS 100% 4.950 3.465 N Rxrb n/a
9 TRCN0000339869 GTCGTGATAACAAAGACTGTA pLKO_005 592 CDS 100% 4.950 3.465 N Rxrb n/a
10 TRCN0000021628 GCGTGACATGAGGATGGACAA pLKO.1 1154 CDS 100% 4.050 2.835 N RXRB n/a
11 TRCN0000222389 TGCACAGAAACTCAGCCCATT pLKO.1 1078 CDS 100% 4.050 2.835 N Rxrb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06904 pDONR223 99.5% 70.7% 75.9% None (many diffs) n/a
2 ccsbBroad304_06904 pLX_304 0% 70.7% 75.9% V5 (many diffs) n/a
3 TRCN0000466911 TCTCCCGACCTTGTTACGGACCAA pLX_317 17.2% 70.7% 75.9% V5 (many diffs) n/a
Download CSV