Construct: ORF TRCN0000466917
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004170.1_s317c1
- Derived from:
- ccsbBroadEn_12391
- DNA Barcode:
- ATATCTAGCATTCAAACTCTACAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP37 (57695)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466917
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_011511541.2 | 46.1% | 44.3% | (many diffs) |
| 2 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_005246724.2 | 30.8% | 29.8% | (many diffs) |
| 3 | human | 57695 | USP37 | ubiquitin specific peptidas... | NM_020935.3 | 30.1% | 29.1% | (many diffs) |
| 4 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_005246720.3 | 30.1% | 29.1% | (many diffs) |
| 5 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_005246721.4 | 30.1% | 29.1% | (many diffs) |
| 6 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_005246722.4 | 30.1% | 29.1% | (many diffs) |
| 7 | human | 57695 | USP37 | ubiquitin specific peptidas... | XM_011511538.3 | 30.1% | 29.1% | (many diffs) |
| 8 | mouse | 319651 | Usp37 | ubiquitin specific peptidas... | NM_001310662.1 | 27.8% | 27% | (many diffs) |
| 9 | mouse | 319651 | Usp37 | ubiquitin specific peptidas... | XM_006496057.3 | 27.5% | 26.8% | (many diffs) |
| 10 | mouse | 319651 | Usp37 | ubiquitin specific peptidas... | NM_176972.4 | 27.2% | 26.4% | (many diffs) |
| 11 | mouse | 319651 | Usp37 | ubiquitin specific peptidas... | XM_006496054.3 | 27.2% | 26.4% | (many diffs) |
| 12 | mouse | 319651 | Usp37 | ubiquitin specific peptidas... | XR_373256.3 | 11.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 972
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tcctctgaag atacatggtc ctatcagaat tcgaagtatg cagactggga 121 ttacaaagtg gaaagaagga tcctttgaaa ttgtagaaaa agagaataaa gtcagcctag 181 tagttcacta caatactgga ggaattccaa ggatatttca gctaagtcat aacattaaaa 241 atgtggtgct tcgacccagt ggagcgaaac aaagccgcct aatgttaact ctgcaagata 301 acagcttctt gtctattgac aaagtaccaa gtaaggatgc agaggaaatg aggttgtttc 361 tagatgcagt ccatcaaaac agacttcctg cagccatgaa accgtctcag gggtctggta 421 gttttggagc cattctgggc agcaggacct cacagaagga aaccagcagg cagctttctt 481 actcagacaa tcaggcttct gcaaaaagag gaagtttgga aactaaagat gatattccat 541 ttcgaaaagt tcttggtaat ccgggtagag gatcgattaa gactgtagca ggaagtggaa 601 tagctcggac gattccttct tTGACATCTA CTTCAACACC TCTTAGATCA GGGTTGCTAG 661 AAAATCGTAC TGAAAAGAGG AAAAGAATGA TATCAACTGG CTCAGAATTG AATGAAGATT 721 ACCCTAAGGA AAATGATTCA TCATCGAACA ACAAGGCCAT GACAGATCCC TCCAGAAAGT 781 ATTTAACCAG CAGTAGAGAA AAGCAGCTGA GTTTGAAACA GTCAGAAGAG AATAGGACAT 841 CAGGGCTTTT ACCTTTACAG TCATCATCCT TTTATGGTAG CAGAGCTGGA TCCAAGGAAC 901 ACTCTTCTGG TGGCACTAAC TTAGACAGAT TTATTGGGTA TAAATACATA AGATACCTGC 961 TAAGCACTTG TTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAATA TCTAGCATTC AAACTCTACA 1141 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t