Transcript: Mouse NM_176972.4

Mus musculus ubiquitin specific peptidase 37 (Usp37), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Usp37 (319651)
Length:
7196
CDS:
376..3315

Additional Resources:

NCBI RefSeq record:
NM_176972.4
NBCI Gene record:
Usp37 (319651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030862 CGCTTTGCAAACCTGCTTATT pLKO.1 1534 CDS 100% 13.200 18.480 N Usp37 n/a
2 TRCN0000030860 CGCCTAATGTTGACTTTACAA pLKO.1 586 CDS 100% 5.625 4.500 N Usp37 n/a
3 TRCN0000030863 GCTACAGAATTAAGTCTTCAA pLKO.1 2881 CDS 100% 4.950 3.960 N Usp37 n/a
4 TRCN0000030859 CGGCTATATCTTCTTCTATAT pLKO.1 3201 CDS 100% 13.200 9.240 N Usp37 n/a
5 TRCN0000030861 GCAGAAGATGATATTCCAGAA pLKO.1 2596 CDS 100% 4.050 2.835 N Usp37 n/a
6 TRCN0000412978 CCACTCCCTCCTCGTTCAATT pLKO_005 1918 CDS 100% 13.200 9.240 N USP37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12391 pDONR223 100% 27.2% 26.4% None (many diffs) n/a
2 ccsbBroad304_12391 pLX_304 0% 27.2% 26.4% V5 (many diffs) n/a
3 TRCN0000466917 ATATCTAGCATTCAAACTCTACAT pLX_317 38.9% 27.2% 26.4% V5 (many diffs) n/a
Download CSV