Construct: ORF TRCN0000466951
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010044.1_s317c1
- Derived from:
- ccsbBroadEn_09114
- DNA Barcode:
- CTTCCGCGACGGGCGACCCGGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBM4B (83759)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466951
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 83759 | RBM4B | RNA binding motif protein 4B | NM_031492.4 | 99.9% | 99.7% | 869C>N |
2 | human | 83759 | RBM4B | RNA binding motif protein 4B | XM_011545297.3 | 99.9% | 99.7% | 869C>N |
3 | human | 83759 | RBM4B | RNA binding motif protein 4B | XM_017018402.2 | 99.9% | 99.7% | 869C>N |
4 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_002896.3 | 85.7% | 89% | (many diffs) |
5 | human | 83759 | RBM4B | RNA binding motif protein 4B | XR_247214.3 | 53.3% | 1_126del;995C>N;1204_2018del | |
6 | human | 83759 | RBM4B | RNA binding motif protein 4B | XR_247213.3 | 51.2% | 1_126del;995C>N;1204_2100del | |
7 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_001198844.2 | 44% | 38.6% | (many diffs) |
8 | human | 83759 | RBM4B | RNA binding motif protein 4B | NM_001286135.2 | 39.3% | 38.4% | (many diffs) |
9 | human | 5936 | RBM4 | RNA binding motif protein 4 | NM_001198843.1 | 38.2% | 38.4% | (many diffs) |
10 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | NM_025717.3 | 90.3% | 96.1% | (many diffs) |
11 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531823.3 | 90.3% | 96.1% | (many diffs) |
12 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531824.3 | 90.3% | 96.1% | (many diffs) |
13 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531825.3 | 90.3% | 96.1% | (many diffs) |
14 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531826.2 | 90.3% | 96.1% | (many diffs) |
15 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290122.1 | 84.9% | 87.8% | (many diffs) |
16 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290123.1 | 84.9% | 87.8% | (many diffs) |
17 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_009032.3 | 84.9% | 87.8% | (many diffs) |
18 | mouse | 102902673 | Gm21992 | predicted gene 21992 | NM_001290127.1 | 64.4% | 66.4% | (many diffs) |
19 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XM_006531827.3 | 39.9% | 38.9% | (many diffs) |
20 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290124.1 | 37.4% | 38.9% | (many diffs) |
21 | mouse | 19653 | Rbm4 | RNA binding motif protein 4 | NM_001290125.1 | 37.4% | 38.9% | (many diffs) |
22 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XR_001782610.1 | 17% | (many diffs) | |
23 | mouse | 66704 | Rbm4b | RNA binding motif protein 4B | XR_001782611.1 | 12.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaagctgttc atcggaaacc ttccccggga ggctacagag caggagattc 121 gctcactctt cgagcagtat gggaaggtgc tggaatgtga catcattaag aattacggct 181 ttgtgcacat agaagacaag acggcagctg aggatgccat acgcaacctg caccattaca 241 agcttcatgg ggtgaacatc aacgtggaag ccagcaagaa taagagcaaa gcttcaacca 301 agttacacgt gggtaacatc agccccactt gtaccaacca agagcttcga gccaagtttg 361 aggagtatgg tccggtcatc gaatgtgaca tcgtgaaaga ttatgccttc gtacacatgg 421 agcgggcaga ggatgcagtg gaggccatca ggggccttga caacacagag tttcaaggca 481 aaagaatgca tgtgcagttg tccacaagcc ggcttcggac tgcccctggt atgggagacc 541 agagtggctg ctatcggtgt gggaaagaag ggcactggtc caaagagtgc ccagtagatc 601 gtacgggtcg tgtggcagac tttactgagc agtataatga acaatatgga gcagttcgaa 661 caccttacac catgggctac ggggaatcca tgtattacaa cgatgcatat ggagcactcg 721 actactataa gcgataccgg gtccgctctt atgaggcagt agcagcggcg gcagcggctt 781 ctgcatacaa ctacgcagag cagaccatgt cccatctgcc tcaagtccaa agcacaactg 841 tgaccagcca cctcaactct acttctgttg atccctatga cagacaccta ttgccaaact 901 ctggcgctgc tgccacttca gctgctatgg ctgntgctgc agccaccact tcctcctact 961 atggaaggga caggagccca cTGCGTCGTG CTGCAGCCAT GCTCCCCACA GTTGGAGAGG 1021 GCTACGGTTA TGGGCCAGAG AGTGAATTAT CTCAGGCTTC CGCAGCTACA CGGAATTCTC 1081 TGTATGACAT GGCCCGGTAT GAACGGGAGC AGTATGTGGA CCGAGCCCGG TACTCAGCCT 1141 TTTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGACT TCCGCGACGG GCGACCCGGA ACACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt