Transcript: Human NM_031492.4

Homo sapiens RNA binding motif protein 4B (RBM4B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RBM4B (83759)
Length:
1806
CDS:
137..1216

Additional Resources:

NCBI RefSeq record:
NM_031492.4
NBCI Gene record:
RBM4B (83759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163239 GCTTCTGCATACAACTACGCA pLKO.1 848 CDS 100% 0.750 1.050 N RBM4B n/a
2 TRCN0000158566 CTCAACTCTACTTCTGTTGAT pLKO.1 923 CDS 100% 0.495 0.693 N RBM4B n/a
3 TRCN0000292296 CTCAACTCTACTTCTGTTGAT pLKO_005 923 CDS 100% 0.495 0.693 N RBM4B n/a
4 TRCN0000159895 GCTTCATGTTTCAGTAAACAA pLKO.1 1313 3UTR 100% 0.563 0.394 N RBM4B n/a
5 TRCN0000292338 GCTTCATGTTTCAGTAAACAA pLKO_005 1313 3UTR 100% 0.563 0.394 N RBM4B n/a
6 TRCN0000159492 CCTTTCACTCTGTTCCTTATA pLKO.1 1415 3UTR 100% 13.200 7.920 N RBM4B n/a
7 TRCN0000292339 CCTTTCACTCTGTTCCTTATA pLKO_005 1415 3UTR 100% 13.200 7.920 N RBM4B n/a
8 TRCN0000158726 GCTGGAATGTGACATCATTAA pLKO.1 220 CDS 100% 13.200 6.600 Y RBM4 n/a
9 TRCN0000162799 CGAGCCAAGTTTGAGGAGTAT pLKO.1 419 CDS 100% 4.950 2.475 Y RBM4B n/a
10 TRCN0000292340 CGAGCCAAGTTTGAGGAGTAT pLKO_005 419 CDS 100% 4.950 2.475 Y RBM4B n/a
11 TRCN0000103724 GCCAGCAAGAATAAGAGCAAA pLKO.1 341 CDS 100% 4.950 2.475 Y Rbm4b n/a
12 TRCN0000161617 GCCAGCAAGAATAAGAGCAAA pLKO.1 341 CDS 100% 4.950 2.475 Y RBM4B n/a
13 TRCN0000164640 GCCAAGTTTGAGGAGTATGGT pLKO.1 422 CDS 100% 3.000 1.500 Y RBM4 n/a
14 TRCN0000338595 GCCAAGTTTGAGGAGTATGGT pLKO_005 422 CDS 100% 3.000 1.500 Y RBM4 n/a
15 TRCN0000160418 CATCATTAAGAATTACGGCTT pLKO.1 232 CDS 100% 2.160 1.080 Y RBM4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09114 pDONR223 100% 99.9% 99.7% None 869C>N n/a
2 ccsbBroad304_09114 pLX_304 0% 99.9% 99.7% V5 869C>N n/a
3 TRCN0000466951 CTTCCGCGACGGGCGACCCGGAAC pLX_317 15.6% 99.9% 99.7% V5 869C>N n/a
4 ccsbBroadEn_01382 pDONR223 100% 85.7% 89.3% None (many diffs) n/a
5 ccsbBroad304_01382 pLX_304 0% 85.7% 89.3% V5 (many diffs) n/a
6 TRCN0000467520 CATTGTCTACCGGTTTAACTCAAT pLX_317 39.8% 85.7% 89.3% V5 (many diffs) n/a
7 ccsbBroadEn_11091 pDONR223 100% 43.1% 39.8% None (many diffs) n/a
8 ccsbBroad304_11091 pLX_304 0% 43.1% 39.8% V5 (many diffs) n/a
9 TRCN0000471664 CTCAACATACTGAACCTTCAGTAA pLX_317 68.7% 43.1% 39.8% V5 (many diffs) n/a
10 ccsbBroadEn_15562 pDONR223 0% 38.2% 38.4% None (many diffs) n/a
11 ccsbBroad304_15562 pLX_304 0% 38.2% 38.4% V5 (many diffs) n/a
12 TRCN0000479076 GACCCGACTCACAATTGGTGACGT pLX_317 84.4% 38.2% 38.4% V5 (many diffs) n/a
Download CSV