Construct: ORF TRCN0000467075
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004177.1_s317c1
- Derived from:
- ccsbBroadEn_10934
- DNA Barcode:
- GAATTTCCCGCCGTAGCTTTTCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNMA1 (3778)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467075
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001271522.2 | 100% | 100% | |
| 2 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001271521.2 | 74.8% | 75% | 380_383delTGCT;384_385ins124 |
| 3 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001271520.2 | 72% | 58.7% | (many diffs) |
| 4 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016221.2 | 71.1% | 61.1% | (many diffs) |
| 5 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322839.2 | 68.5% | 56.4% | 377_543del;672_735del |
| 6 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016220.2 | 62.2% | 54.1% | (many diffs) |
| 7 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539784.2 | 20.7% | 18.1% | (many diffs) |
| 8 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016219.2 | 20.4% | 17.9% | (many diffs) |
| 9 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322832.2 | 13.6% | 11.6% | (many diffs) |
| 10 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016222.2 | 13.6% | 11.6% | (many diffs) |
| 11 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_002247.4 | 13.5% | 11.5% | (many diffs) |
| 12 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269796.2 | 13.5% | 11.5% | (many diffs) |
| 13 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322829.2 | 13.5% | 11.5% | (many diffs) |
| 14 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322836.2 | 13.5% | 11.5% | (many diffs) |
| 15 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447985.1 | 13.5% | 11.5% | (many diffs) |
| 16 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001014797.3 | 13.5% | 11.5% | (many diffs) |
| 17 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001271518.2 | 13.3% | 12.1% | (many diffs) |
| 18 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_006717826.2 | 13.2% | 11.3% | (many diffs) |
| 19 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269792.2 | 13.2% | 11.3% | (many diffs) |
| 20 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539785.2 | 13.2% | 11.3% | (many diffs) |
| 21 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001271519.2 | 13.2% | 11.3% | (many diffs) |
| 22 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322835.2 | 13.2% | 11.3% | (many diffs) |
| 23 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322837.2 | 13.2% | 11.2% | (many diffs) |
| 24 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269789.2 | 13.2% | 11.2% | (many diffs) |
| 25 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539783.2 | 13.2% | 11.2% | (many diffs) |
| 26 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001322830.2 | 13.2% | 11.2% | (many diffs) |
| 27 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001161353.2 | 13.1% | 11.2% | (many diffs) |
| 28 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269787.4 | 13% | 11.1% | (many diffs) |
| 29 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447990.1 | 13% | 11.1% | (many diffs) |
| 30 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447988.1 | 12.9% | 11% | (many diffs) |
| 31 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447989.1 | 12.9% | 11% | (many diffs) |
| 32 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447984.1 | 12.9% | 11% | (many diffs) |
| 33 | human | 3778 | KCNMA1 | potassium calcium-activated... | NM_001161352.2 | 12.9% | 11% | (many diffs) |
| 34 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269781.2 | 12.9% | 11% | (many diffs) |
| 35 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016215.2 | 12.9% | 11% | (many diffs) |
| 36 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269778.2 | 12.9% | 11% | (many diffs) |
| 37 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539780.2 | 12.9% | 11% | (many diffs) |
| 38 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_005269776.4 | 12.7% | 10.8% | (many diffs) |
| 39 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539778.2 | 12.6% | 10.8% | (many diffs) |
| 40 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539777.2 | 12.6% | 10.7% | (many diffs) |
| 41 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016217.1 | 12.6% | 11% | (many diffs) |
| 42 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539782.2 | 12.6% | 11% | (many diffs) |
| 43 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539781.3 | 12.5% | 11% | (many diffs) |
| 44 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_024447987.1 | 12.4% | 10.6% | (many diffs) |
| 45 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016214.2 | 12.3% | 10.8% | (many diffs) |
| 46 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016213.2 | 12.3% | 10.8% | (many diffs) |
| 47 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539779.2 | 12.3% | 10.7% | (many diffs) |
| 48 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016212.2 | 12.3% | 10.7% | (many diffs) |
| 49 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016211.2 | 12.2% | 10.7% | (many diffs) |
| 50 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539775.2 | 12% | 10.5% | (many diffs) |
| 51 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539774.2 | 12% | 10.5% | (many diffs) |
| 52 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016210.2 | 12% | 10.5% | (many diffs) |
| 53 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_011539773.2 | 12% | 10.5% | (many diffs) |
| 54 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016209.2 | 11.7% | 10.3% | (many diffs) |
| 55 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016208.2 | 11.7% | 10.3% | (many diffs) |
| 56 | human | 3778 | KCNMA1 | potassium calcium-activated... | XM_017016207.2 | 11.7% | 10.3% | (many diffs) |
| 57 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518613.3 | 21% | 19% | (many diffs) |
| 58 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253374.1 | 12.9% | 11.4% | (many diffs) |
| 59 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253378.1 | 12.6% | 11.4% | (many diffs) |
| 60 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253375.1 | 12.6% | 11.4% | (many diffs) |
| 61 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253376.1 | 12.6% | 11.4% | (many diffs) |
| 62 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253377.1 | 12.6% | 11.4% | (many diffs) |
| 63 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315883.1 | 12.5% | 11.3% | (many diffs) |
| 64 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518610.3 | 12.5% | 11.3% | (many diffs) |
| 65 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253373.1 | 12.5% | 11.3% | (many diffs) |
| 66 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315882.1 | 12.5% | 11.3% | (many diffs) |
| 67 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315881.1 | 12.3% | 11.1% | (many diffs) |
| 68 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315880.1 | 12.3% | 11.1% | (many diffs) |
| 69 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253370.1 | 12.3% | 11.1% | (many diffs) |
| 70 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253371.1 | 12.3% | 11.1% | (many diffs) |
| 71 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253372.1 | 12.3% | 11.1% | (many diffs) |
| 72 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315878.1 | 12.2% | 11.1% | (many diffs) |
| 73 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315879.1 | 12.2% | 11.1% | (many diffs) |
| 74 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253369.1 | 12.2% | 11.1% | (many diffs) |
| 75 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253368.1 | 12.2% | 11.1% | (many diffs) |
| 76 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315877.1 | 12.2% | 11.1% | (many diffs) |
| 77 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315876.1 | 12.2% | 11% | (many diffs) |
| 78 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253367.1 | 12% | 10.9% | (many diffs) |
| 79 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315887.1 | 12% | 10.9% | (many diffs) |
| 80 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315875.1 | 12% | 10.9% | (many diffs) |
| 81 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253366.1 | 12% | 10.9% | (many diffs) |
| 82 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315886.1 | 12% | 10.9% | (many diffs) |
| 83 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253365.1 | 12% | 10.8% | (many diffs) |
| 84 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518609.3 | 12% | 10.8% | (many diffs) |
| 85 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315885.1 | 12% | 10.8% | (many diffs) |
| 86 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253364.1 | 12% | 10.8% | (many diffs) |
| 87 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_010610.3 | 12% | 10.8% | (many diffs) |
| 88 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315874.1 | 12% | 10.8% | (many diffs) |
| 89 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315884.1 | 12% | 10.8% | (many diffs) |
| 90 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518606.3 | 11.9% | 10.8% | (many diffs) |
| 91 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253363.1 | 11.9% | 10.8% | (many diffs) |
| 92 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253362.1 | 11.9% | 10.8% | (many diffs) |
| 93 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518605.3 | 11.9% | 10.8% | (many diffs) |
| 94 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253361.1 | 11.9% | 10.8% | (many diffs) |
| 95 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253360.1 | 11.8% | 10.6% | (many diffs) |
| 96 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315873.1 | 11.8% | 10.6% | (many diffs) |
| 97 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253359.1 | 11.7% | 10.6% | (many diffs) |
| 98 | mouse | 16531 | Kcnma1 | potassium large conductance... | NM_001253358.1 | 11.7% | 10.6% | (many diffs) |
| 99 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315872.1 | 11.7% | 10.6% | (many diffs) |
| 100 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_011244967.2 | 11.7% | 10.6% | (many diffs) |
| 101 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518603.3 | 11.7% | 10.5% | (many diffs) |
| 102 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518602.3 | 11.6% | 10.5% | (many diffs) |
| 103 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315871.1 | 11.5% | 10.4% | (many diffs) |
| 104 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518599.3 | 11.5% | 10.4% | (many diffs) |
| 105 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_017315870.1 | 11.4% | 10.3% | (many diffs) |
| 106 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518595.3 | 11.4% | 10.3% | (many diffs) |
| 107 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518594.3 | 11.2% | 10.1% | (many diffs) |
| 108 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518593.3 | 11.2% | 10.1% | (many diffs) |
| 109 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518592.3 | 11.2% | 10.1% | (many diffs) |
| 110 | mouse | 16531 | Kcnma1 | potassium large conductance... | XM_006518591.3 | 11.2% | 10.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 570
- ORF length:
- 504
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc aaatggtggc ggcggcggcg gcggcagcag cggcggcggc ggcggcggcg 121 gaggcagcag tcttagaatg agtagcaata tccacgcgaa ccatctcagc ctagacgcgt 181 cctcctcctc ctcctcctcc tcttcctctt cttcttcttc ctcctcctct tcctcctcgt 241 cctcggtcca cgagcccaag atggatgcgc tcatcatccc ggtgaccatg gaggtgccgt 301 gcgacagccg gggccaacgc atgtgGTGGG CTTTCCTGGC CTCCTCCATG GTGACTTTCT 361 TCGGGGGCCT CTTCATCATC TTGCTCTGGC GGACGCTCAA GTACCTGTGG ACCGTGTGCT 421 GCCACTGCGG GGGCAAGACG AAGGCCACCC ACTTTGGGTC CCCGGAAATG CCACCAGCAG 481 CGCGGAGCTG GAGCGGGAGT CCGCCTGAGG CCGCGGTTTT ACGCGGAGCG TCTTCCCTGG 541 CGCTCGAGGT GGCTAGATGT CGTCGGCTTT ACCCAACTTT CTTGTACAAA GTGGTTGATA 601 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 661 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGAATT 721 TCCCGCCGTA GCTTTTCACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 781 tgaaagatt