Transcript: Mouse NM_001253360.1

Mus musculus potassium large conductance calcium-activated channel, subfamily M, alpha member 1 (Kcnma1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Kcnma1 (16531)
Length:
5051
CDS:
81..3854

Additional Resources:

NCBI RefSeq record:
NM_001253360.1
NBCI Gene record:
Kcnma1 (16531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039053 GCCCTCGTAATATACTTCATA pLKO.1 651 CDS 100% 5.625 7.875 N Kcnma1 n/a
2 TRCN0000039050 CCCTGAAATCATAGAGTTAAT pLKO.1 1232 CDS 100% 13.200 10.560 N Kcnma1 n/a
3 TRCN0000000211 TGGCAGAAATACTACTTGGAA pLKO.1 1845 CDS 100% 3.000 2.400 N KCNMA1 n/a
4 TRCN0000039052 CCACCCAAAGATCAGGATCAT pLKO.1 1625 CDS 100% 4.950 3.465 N Kcnma1 n/a
5 TRCN0000039049 GCAGGCTAATTCCCAAGGATT pLKO.1 2792 CDS 100% 4.950 3.465 N Kcnma1 n/a
6 TRCN0000039051 GCGACATACTTCAATGACAAT pLKO.1 3132 CDS 100% 4.950 3.465 N Kcnma1 n/a
7 TRCN0000000210 CCCAATAGAATCCTGCCAGAA pLKO.1 683 CDS 100% 4.050 2.835 N KCNMA1 n/a
8 TRCN0000000212 GTCAAGATAGAGTCAGCAGAT pLKO.1 1515 CDS 100% 4.050 2.835 N KCNMA1 n/a
9 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 5020 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253360.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10934 pDONR223 100% 11.8% 10.6% None (many diffs) n/a
2 ccsbBroad304_10934 pLX_304 0% 11.8% 10.6% V5 (many diffs) n/a
3 TRCN0000467075 GAATTTCCCGCCGTAGCTTTTCAC pLX_317 48.6% 11.8% 10.6% V5 (many diffs) n/a
Download CSV